ID: 1051556198

View in Genome Browser
Species Human (GRCh38)
Location 9:18385100-18385122
Sequence CATTACAAGCAAAATTTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051556193_1051556198 4 Left 1051556193 9:18385073-18385095 CCCAGAGCACACAGTCAAATGGG No data
Right 1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG No data
1051556191_1051556198 7 Left 1051556191 9:18385070-18385092 CCTCCCAGAGCACACAGTCAAAT No data
Right 1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG No data
1051556195_1051556198 3 Left 1051556195 9:18385074-18385096 CCAGAGCACACAGTCAAATGGGG No data
Right 1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG No data
1051556189_1051556198 12 Left 1051556189 9:18385065-18385087 CCTTCCCTCCCAGAGCACACAGT No data
Right 1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG No data
1051556190_1051556198 8 Left 1051556190 9:18385069-18385091 CCCTCCCAGAGCACACAGTCAAA No data
Right 1051556198 9:18385100-18385122 CATTACAAGCAAAATTTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051556198 Original CRISPR CATTACAAGCAAAATTTGGA TGG Intergenic
No off target data available for this crispr