ID: 1051556265

View in Genome Browser
Species Human (GRCh38)
Location 9:18385823-18385845
Sequence TGCACCATGTGTTGCTAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051556265_1051556271 3 Left 1051556265 9:18385823-18385845 CCAAACTAGCAACACATGGTGCA No data
Right 1051556271 9:18385849-18385871 AAGGAGTTATAGGCAGTGGGTGG No data
1051556265_1051556268 -7 Left 1051556265 9:18385823-18385845 CCAAACTAGCAACACATGGTGCA No data
Right 1051556268 9:18385839-18385861 TGGTGCAGGAAAGGAGTTATAGG No data
1051556265_1051556272 7 Left 1051556265 9:18385823-18385845 CCAAACTAGCAACACATGGTGCA No data
Right 1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG No data
1051556265_1051556269 -1 Left 1051556265 9:18385823-18385845 CCAAACTAGCAACACATGGTGCA No data
Right 1051556269 9:18385845-18385867 AGGAAAGGAGTTATAGGCAGTGG No data
1051556265_1051556270 0 Left 1051556265 9:18385823-18385845 CCAAACTAGCAACACATGGTGCA No data
Right 1051556270 9:18385846-18385868 GGAAAGGAGTTATAGGCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051556265 Original CRISPR TGCACCATGTGTTGCTAGTT TGG (reversed) Intergenic
No off target data available for this crispr