ID: 1051556272

View in Genome Browser
Species Human (GRCh38)
Location 9:18385853-18385875
Sequence AGTTATAGGCAGTGGGTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051556264_1051556272 8 Left 1051556264 9:18385822-18385844 CCCAAACTAGCAACACATGGTGC No data
Right 1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG No data
1051556265_1051556272 7 Left 1051556265 9:18385823-18385845 CCAAACTAGCAACACATGGTGCA No data
Right 1051556272 9:18385853-18385875 AGTTATAGGCAGTGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051556272 Original CRISPR AGTTATAGGCAGTGGGTGGC AGG Intergenic
No off target data available for this crispr