ID: 1051566552

View in Genome Browser
Species Human (GRCh38)
Location 9:18505723-18505745
Sequence TGTTATGTATAGCAAGTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051566550_1051566552 22 Left 1051566550 9:18505678-18505700 CCATGGTAATATTTTTAATGAAA 0: 1
1: 1
2: 8
3: 75
4: 724
Right 1051566552 9:18505723-18505745 TGTTATGTATAGCAAGTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051566552 Original CRISPR TGTTATGTATAGCAAGTAGG AGG Intronic
No off target data available for this crispr