ID: 1051569089

View in Genome Browser
Species Human (GRCh38)
Location 9:18535343-18535365
Sequence CAAAATGCTGATAGTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051569089_1051569091 4 Left 1051569089 9:18535343-18535365 CCTGTATCACTATCAGCATTTTG No data
Right 1051569091 9:18535370-18535392 AAGCCATTCAACAAGACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051569089 Original CRISPR CAAAATGCTGATAGTGATAC AGG (reversed) Intronic