ID: 1051569876

View in Genome Browser
Species Human (GRCh38)
Location 9:18543807-18543829
Sequence CCTAACTTACTGGGGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 151}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051569876_1051569889 19 Left 1051569876 9:18543807-18543829 CCCCCCAGCCCCAGTAAGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1051569889 9:18543849-18543871 TCTCGGCCTTCTTCTGACTGTGG No data
1051569876_1051569886 2 Left 1051569876 9:18543807-18543829 CCCCCCAGCCCCAGTAAGTTAGG 0: 1
1: 0
2: 0
3: 8
4: 151
Right 1051569886 9:18543832-18543854 TTCTGCTTTTCCTCTCCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051569876 Original CRISPR CCTAACTTACTGGGGCTGGG GGG (reversed) Intronic
900794812 1:4701497-4701519 CCTCCCTTACTGGGACTGGGAGG + Intronic
902176302 1:14653440-14653462 GCCAGCTGACTGGGGCTGGGTGG - Intronic
902458337 1:16552608-16552630 CCTAACCTTGTGGGGCAGGGAGG + Intergenic
902475870 1:16686832-16686854 CCTAACCTTGTGGGGCAGGGAGG + Intergenic
902493823 1:16855308-16855330 CCTAACCTTGTGGGGCAGGGAGG - Intronic
902697523 1:18150339-18150361 CCTTCCTTACGGAGGCTGGGAGG + Intronic
903151521 1:21413367-21413389 CCTAACCTTGTGGGGCAGGGAGG + Intergenic
907547817 1:55277411-55277433 TCTGACTCACTGGGTCTGGGTGG + Intergenic
911532813 1:99065806-99065828 CTTTACTTACTGGTGCTGAGAGG - Intergenic
913081285 1:115389351-115389373 TCTATCTCACTGGGGCTGGTTGG - Intergenic
913378563 1:118184366-118184388 CCTCATTTACTGAAGCTGGGTGG + Intronic
913413546 1:118579539-118579561 CTTAACCTACCGGGGGTGGGGGG - Intergenic
915560441 1:156683967-156683989 CCTAACTCTCTGGGTCTGTGGGG + Intergenic
922040265 1:221889462-221889484 CCCAACTTCCTGGAGCTGGTTGG + Intergenic
923251674 1:232184224-232184246 CCCATCTTAGTGGGGGTGGGGGG - Intergenic
1062926479 10:1319354-1319376 CCAAACTTCCTGGGGGTGGGTGG + Intronic
1063116035 10:3072507-3072529 CAAAAATTACTGGGTCTGGGAGG + Intronic
1064516446 10:16154547-16154569 CCTAATTGAGTGGGGCGGGGAGG - Intergenic
1065588382 10:27241523-27241545 CCTGGCTCCCTGGGGCTGGGTGG - Intronic
1065995492 10:31055929-31055951 CCTTACTACCTGGGGCAGGGGGG - Intergenic
1067939701 10:50643980-50644002 TCTAACTTACAGTGCCTGGGAGG - Intergenic
1070669121 10:78365743-78365765 GCTGACTTGATGGGGCTGGGGGG - Intergenic
1074150561 10:110755921-110755943 CCTAACTTGAAGGGGCTGGATGG - Intronic
1076674918 10:132142702-132142724 CCTCCCTTACTGAGGCTCGGAGG + Intronic
1078890676 11:15555302-15555324 CCACACTTATGGGGGCTGGGTGG - Intergenic
1079183454 11:18214817-18214839 CCTATTTTTCTGTGGCTGGGTGG - Intronic
1080050653 11:27855827-27855849 CCTTTCTTACCTGGGCTGGGGGG - Intergenic
1080457187 11:32428309-32428331 CCTAACGTACTTGGGATGGAGGG + Intronic
1084375417 11:68773564-68773586 CCTAACTTACTAGGGCTTCTGGG - Intronic
1087965112 11:104403295-104403317 CCTTATTTACTGGGGGAGGGGGG + Intergenic
1090195514 11:124813089-124813111 CCTCACTTACAAGGGCTGAGGGG - Intergenic
1090615715 11:128512734-128512756 CCTGACTTACTGGGCCTGTCAGG + Intronic
1091286335 11:134410728-134410750 CCTAAGTTACTAGGGCTGTGGGG - Intronic
1093346259 12:18040361-18040383 CCTCACTGCCTGGGGCTGGCGGG - Intergenic
1095163277 12:38941497-38941519 CCTATCCTACTGTGGCTGTGAGG - Intergenic
1096490087 12:52008313-52008335 CCTAACTTTTTGGTCCTGGGAGG - Intronic
1096704342 12:53409350-53409372 CCTCACTTTCAGGGGCTCGGGGG + Exonic
1099953160 12:89326429-89326451 CCAAAAATCCTGGGGCTGGGAGG + Intergenic
1100813703 12:98365014-98365036 CAGAACTTACTGTGGCTGGATGG - Intergenic
1106717934 13:32410193-32410215 CCTGACTACGTGGGGCTGGGCGG + Intronic
1106721304 13:32437503-32437525 CCTAACCTAGTGGGGGTGGCTGG - Intronic
1109563357 13:64078670-64078692 CCAAACCTACGGGGGCAGGGGGG + Intergenic
1111111178 13:83711628-83711650 CCTAACTTCCAGGGGTGGGGAGG + Intergenic
1113556137 13:111236810-111236832 CCAAAATTACCTGGGCTGGGTGG + Intronic
1114811914 14:25910898-25910920 GCTAAATGACTGGGGCTAGGTGG - Intergenic
1122939491 14:104974867-104974889 CCCCACTTGCTGGGGCTTGGGGG + Intronic
1127149667 15:56060457-56060479 CCTAACCTGCTGGGGCTGCTGGG + Intergenic
1127800966 15:62477220-62477242 CCTAACTCAGTAGGTCTGGGTGG + Intronic
1129677375 15:77639232-77639254 CCCAACTTACTGAAACTGGGAGG + Intronic
1131692997 15:94846405-94846427 CCTCACCTGCTGGGGTTGGGGGG - Intergenic
1131823210 15:96293760-96293782 CCTAACATGGTGGGGGTGGGGGG + Intergenic
1132389945 15:101431206-101431228 CCTAACTTAATGGGGGCTGGGGG + Intronic
1133061773 16:3179531-3179553 CCTGACCTGCTGGGGTTGGGAGG + Intergenic
1133871994 16:9697473-9697495 CCTAAATTACAAGGGCTGAGAGG + Intergenic
1138934199 16:61698649-61698671 CCTAAAATACTGGAGCTGGCAGG + Intronic
1142065665 16:88060960-88060982 TCTGACTCACTGGGGCAGGGTGG - Intronic
1142680208 17:1543161-1543183 TCTGACTCACTGGGGCTTGGAGG - Intronic
1144118212 17:12122196-12122218 GCTAACTTACTGAGGATGAGAGG + Intronic
1146915041 17:36673037-36673059 CCTGACTTCCTGGGAGTGGGGGG + Intergenic
1147053640 17:37817211-37817233 ACTATTTTACTGGGGTTGGGAGG + Intergenic
1154134109 18:11761064-11761086 CCTCAGTTGCTGGGGCTGGTTGG + Intronic
1156969662 18:43139628-43139650 CCTCACTGCCCGGGGCTGGGGGG - Intergenic
1157444771 18:47736493-47736515 CCTCACCTGCTGGGGATGGGAGG - Intergenic
1165408084 19:35642781-35642803 CCTAGGTTCCTGGGACTGGGTGG + Intronic
1165938964 19:39405739-39405761 CCCCACTTGCTGGGGTTGGGTGG - Intergenic
1167503000 19:49857822-49857844 CCTCACGGACTGTGGCTGGGAGG + Intronic
1168103521 19:54153381-54153403 CATGACTCACTGGGGTTGGGAGG - Intronic
1168122535 19:54259989-54260011 CCTATCTTACTGTGGCTGAGTGG + Intronic
1202709883 1_KI270714v1_random:12686-12708 CCTAACCTTGTGGGGCAGGGAGG + Intergenic
926224145 2:10955417-10955439 ACTAGCTGGCTGGGGCTGGGTGG - Intergenic
930234740 2:48877717-48877739 TCTCTCTTACTGAGGCTGGGTGG - Intergenic
931992211 2:67802034-67802056 CCTGACTCACAGGGCCTGGGCGG - Intergenic
933983952 2:87575295-87575317 CCTGCTTTGCTGGGGCTGGGGGG + Intergenic
936309903 2:111375501-111375523 CCTGCTTTGCTGGGGCTGGGGGG - Intergenic
937301645 2:120846375-120846397 CATAACTGGCTGGGCCTGGGAGG + Intronic
941528301 2:166632675-166632697 CTGCACTGACTGGGGCTGGGGGG + Intergenic
943166081 2:184327902-184327924 CCTTACTGCCTGGGGCTGGCGGG + Intergenic
943810595 2:192183338-192183360 GCTAAGTGACTGGGGCAGGGTGG - Intronic
946735120 2:222746329-222746351 GCTAAGTTACTTGAGCTGGGAGG + Intergenic
1170816948 20:19721605-19721627 CCTAGGTTACTGGGTTTGGGGGG + Exonic
1171164092 20:22955526-22955548 CCTTTCTAACTGGGGCTTGGAGG + Intergenic
1173135348 20:40434154-40434176 CCTTACTTCATGGGCCTGGGAGG - Intergenic
1174113446 20:48211719-48211741 ACCAACTTCCTGGGGCTGTGGGG + Intergenic
1175709231 20:61206080-61206102 CCTGGCTTCCTGGGGCTGGGGGG - Intergenic
1176235637 20:64052308-64052330 CCTTTCTGACTGGGGCTTGGGGG - Intronic
1176344838 21:5733727-5733749 CCTCACTGCCTGGGGCTGGCGGG + Intergenic
1176351652 21:5854311-5854333 CCTCACTGCCTGGGGCTGGCGGG + Intergenic
1176499989 21:7590728-7590750 CCTCACTGCCTGGGGCTGGCGGG - Intergenic
1176539159 21:8131797-8131819 CCTCACTGCCTGGGGCTGGCGGG + Intergenic
1176558110 21:8314842-8314864 CCTCACTGCCTGGGGCTGGCGGG + Intergenic
1180061075 21:45385395-45385417 ACAAACCTACTGGGGCTGGCAGG - Intergenic
1180964025 22:19776343-19776365 CCTCCCTCACTGGGGGTGGGAGG + Intronic
1181064017 22:20297168-20297190 CCCAACATACAGGGCCTGGGTGG + Intergenic
1182461097 22:30484681-30484703 CCTAACTGATAGGGCCTGGGTGG + Intergenic
1184999776 22:48238314-48238336 CCTGACTTGGCGGGGCTGGGTGG - Intergenic
952059805 3:29494273-29494295 CCTAACTTACAGGGTGTGGGTGG - Intronic
958810763 3:98858177-98858199 CCTCACTGCCTGGGGCTGGCAGG + Intronic
960207358 3:114918707-114918729 CCTATCCTACTGTGGCTGAGTGG + Intronic
964083794 3:152791332-152791354 CCTAACTTAATAGGGGTGAGGGG - Intergenic
964378515 3:156073267-156073289 CCTCACTAACTGGGGCCGGCGGG - Intronic
965151470 3:164982629-164982651 CCAAACTTTCTGAGCCTGGGTGG - Intronic
966076055 3:175937480-175937502 CCTCACTTCCCGGGGCTGGCAGG - Intergenic
968412813 4:404212-404234 CCTCACTGCCTGGGGCTGGCGGG + Intergenic
968449058 4:666635-666657 CCGAGCTGACTGGGGCAGGGTGG + Intronic
970677192 4:18464472-18464494 CCAAACTAAATGGAGCTGGGAGG - Intergenic
978917983 4:114148796-114148818 CCTCACTGCCTGGGGCTGGTGGG + Intergenic
983495143 4:168435096-168435118 CCTTACTGACTGGGGGTTGGGGG - Intronic
983552818 4:169034612-169034634 CCAAAATTAGTGGGGCTTGGTGG - Intergenic
983752833 4:171298382-171298404 CCTCATTTCCTGGGGCTGGCAGG - Intergenic
984630523 4:182055556-182055578 GCTACCTTCCTGGGGCTAGGAGG + Intergenic
991143479 5:63273909-63273931 CCAAACTGACTGGGGATGGAAGG - Intergenic
992476741 5:77110088-77110110 CAAAACTTACTGGGGCATGGTGG - Intergenic
995232995 5:109792139-109792161 CTTAAATTATTGGTGCTGGGAGG - Intronic
995677795 5:114682717-114682739 GCTAACTCTCTGGGGCTGTGTGG + Intergenic
997464017 5:134074667-134074689 ACTGAGTGACTGGGGCTGGGTGG - Intergenic
998056223 5:139080052-139080074 CCAACTTTACTGGGGGTGGGGGG + Intronic
1001416906 5:171551670-171551692 CACAGCTTACTGGGGTTGGGGGG + Intergenic
1001420970 5:171586840-171586862 CCTTGCTTTCTGGGGGTGGGGGG + Intergenic
1002105836 5:176879138-176879160 CCCTTCTTACTGGGGCTCGGAGG - Intronic
1002758009 6:179701-179723 CCTCACTGTCTGGGGCTGGTGGG - Intergenic
1004235551 6:13872174-13872196 CCTCATTTCCTGGGGCTGGCAGG + Intergenic
1005978249 6:30816550-30816572 CCTCACTGCCTGGGGCTGGCAGG + Intergenic
1006188440 6:32193031-32193053 TCTTACTTACCGGGACTGGGAGG + Intronic
1006573175 6:35022131-35022153 CCTGACTTTCTCAGGCTGGGTGG - Intronic
1011338357 6:86285028-86285050 CCTCACTGCCTGGGGCTGGTGGG + Intergenic
1011620099 6:89234698-89234720 CCTCACTGCCTGGGGCTGGTGGG + Intergenic
1017010184 6:150058100-150058122 CCTGACTAACTGGGGGTGGGGGG - Intergenic
1017221879 6:151975009-151975031 CCTAGATTACTCAGGCTGGGTGG + Intronic
1017422229 6:154284437-154284459 CCTAACTGCATGGGTCTGGGAGG - Intronic
1017598455 6:156055571-156055593 CCTCCCCTACTGGGTCTGGGAGG - Intergenic
1018428742 6:163706896-163706918 TCTGACTCACTGGGTCTGGGAGG - Intergenic
1018898285 6:168036410-168036432 CCTGACTCTCTGGGGCGGGGAGG - Intronic
1033068503 7:138179815-138179837 CCTAACTTTCTCAGGATGGGAGG - Intergenic
1034840777 7:154393572-154393594 CCAAAGTTACTGGGTCTGAGAGG - Intronic
1042191496 8:66192028-66192050 CCAAACTGCCTGAGGCTGGGTGG + Intergenic
1042365960 8:67936638-67936660 CCTCACAGAGTGGGGCTGGGAGG + Intergenic
1045560256 8:103254756-103254778 CTGAACTGACTGGGGTTGGGGGG + Intergenic
1045665191 8:104477216-104477238 TCTATCTTCCTGGGGCTGGATGG - Intergenic
1045844290 8:106615481-106615503 CCGGACTTACTGGAGCTGTGGGG - Intronic
1048655420 8:136530663-136530685 CCTCACTGCCTGGGGCTGGCGGG + Intergenic
1049197736 8:141324786-141324808 GCTGACTTGGTGGGGCTGGGGGG + Intergenic
1049800499 8:144515449-144515471 CCTCACTTGCTGGGGCAGGCAGG + Exonic
1051569876 9:18543807-18543829 CCTAACTTACTGGGGCTGGGGGG - Intronic
1055282674 9:74692540-74692562 ACTAACCTACTGCGCCTGGGGGG + Exonic
1058727514 9:107817901-107817923 CCTCACTTCCCGGGGCTGGCAGG - Intergenic
1060042142 9:120308844-120308866 CCTGACTTCCTGGGGGTGGGGGG + Intergenic
1060269018 9:122128242-122128264 CCCCACTTGCTGGGGGTGGGGGG - Intergenic
1061814103 9:133182950-133182972 GCTAACTTTATGGGGTTGGGGGG - Intergenic
1203460437 Un_GL000220v1:31239-31261 CCTCACTGCCTGGGGCTGGCAGG + Intergenic
1186221226 X:7351411-7351433 CCTGATTTACAGGGGCTTGGGGG - Exonic
1192452521 X:71253005-71253027 ACTGAGTTGCTGGGGCTGGGGGG - Exonic
1196099348 X:111831397-111831419 CCTAGATGACTGGGGGTGGGTGG + Intronic
1197550631 X:127888158-127888180 ACTATCTTACTGGGGCTTGTGGG + Intergenic
1198248583 X:134856477-134856499 ACTAACTGAATAGGGCTGGGTGG - Intergenic
1200846089 Y:7833463-7833485 CCAAACTTTATAGGGCTGGGAGG - Intergenic
1202100596 Y:21303819-21303841 CCTCACTGCCTGGGGCCGGGTGG + Intergenic
1202271507 Y:23078593-23078615 CCTCACTGCCTGGGGCTGGCAGG + Intergenic
1202294519 Y:23342089-23342111 CCTCACTGCCTGGGGCTGGCAGG - Intergenic
1202424502 Y:24712337-24712359 CCTCACTGCCTGGGGCTGGCAGG + Intergenic
1202446287 Y:24957748-24957770 CCTCACTGCCTGGGGCTGGCAGG - Intergenic