ID: 1051570029

View in Genome Browser
Species Human (GRCh38)
Location 9:18545354-18545376
Sequence CCATAACACCAGGAGCTATA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051570025_1051570029 17 Left 1051570025 9:18545314-18545336 CCTGTCAGGTTTGTAAATGCCGA 0: 1
1: 0
2: 0
3: 1
4: 39
Right 1051570029 9:18545354-18545376 CCATAACACCAGGAGCTATATGG No data
1051570026_1051570029 -2 Left 1051570026 9:18545333-18545355 CCGAAGCACATGCTCATTTCACC 0: 1
1: 0
2: 2
3: 35
4: 288
Right 1051570029 9:18545354-18545376 CCATAACACCAGGAGCTATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051570029 Original CRISPR CCATAACACCAGGAGCTATA TGG Intronic
No off target data available for this crispr