ID: 1051574381

View in Genome Browser
Species Human (GRCh38)
Location 9:18598324-18598346
Sequence GACCCAGGTTTGAGTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051574381 Original CRISPR GACCCAGGTTTGAGTGTTTC TGG (reversed) Intronic
921711796 1:218380267-218380289 GGCCTAGGTTTGTGTGTTTGGGG + Intronic
1064242985 10:13647338-13647360 GGCCCAGGCATGAGTATTTCTGG - Intronic
1065870075 10:29948663-29948685 GACCCTTCTTTGAGTGTGTCTGG + Intergenic
1066363263 10:34751642-34751664 GACCCAGGCTAGAGTGTTGTGGG + Intronic
1068959002 10:62847724-62847746 GACCCAGGTCTGAGTTTTCTAGG - Intronic
1070823268 10:79375621-79375643 CTCCCAGCTTTGAGTGCTTCTGG + Intergenic
1083804949 11:65067899-65067921 AGCCCAGGTTTGAATGTTTCTGG + Intronic
1087058949 11:93959916-93959938 GACCCAGGTTTGGGTGGTCCAGG - Intergenic
1089951415 11:122531273-122531295 GACCCTTGTTTTAGAGTTTCTGG + Intergenic
1092260655 12:6951789-6951811 GAACCAGGAATGAGTGGTTCAGG - Intronic
1092355885 12:7794836-7794858 GCACCAGGTCTGAGTGTTCCAGG - Exonic
1092368484 12:7896851-7896873 GCACCAGGTCTGAGTGTTCCAGG + Intergenic
1092368718 12:7898644-7898666 GCACCAGGTCTGAGTGTTCCAGG - Intergenic
1096666033 12:53165850-53165872 GACCCTGCTTTCAGTGTTTTGGG - Intronic
1103000205 12:117379788-117379810 GAGCCAAGTTTGCATGTTTCAGG + Intronic
1106209855 13:27631721-27631743 GACCCAGTTTTAAGTGCTTGGGG - Intronic
1107293884 13:38889225-38889247 GCCCCATGTTTTAGTGTTTTAGG + Intergenic
1109552025 13:63916549-63916571 CACCAAGGACTGAGTGTTTCAGG - Intergenic
1110523995 13:76514554-76514576 GCCACAGGTTTCAGTGTTTCAGG - Intergenic
1113672780 13:112186198-112186220 GCCCCAGGTCTGAGTGTCACTGG + Intergenic
1118653368 14:67921866-67921888 GGCCCCTGTTTGAGTGTTTATGG + Intronic
1121022616 14:90590370-90590392 GACCCAGATTTGAGGCTTGCAGG - Intronic
1121148144 14:91604639-91604661 GCACCAGGTCTGAGTGTTCCAGG + Intronic
1121671191 14:95711904-95711926 AACCCAGGTGTGAGGATTTCAGG + Intronic
1121737238 14:96226978-96227000 GACCCAGGTTAGAGGGACTCAGG - Intronic
1125032227 15:35084430-35084452 GCACCAGGTCTGAGTGTTCCAGG + Intergenic
1126699770 15:51357520-51357542 GACACAGGTGTGAGGCTTTCTGG + Intronic
1127873420 15:63091656-63091678 GACCCAGGTTTGAATGTCACTGG - Intergenic
1128801754 15:70501455-70501477 GAGCCAGGTTTGGGTGACTCTGG - Intergenic
1131330725 15:91496922-91496944 GACTCAAGTATAAGTGTTTCTGG - Intergenic
1133921889 16:10160901-10160923 GAGCCAGGTTTTGGGGTTTCGGG + Intronic
1137679747 16:50330182-50330204 GACCCAGGATTCAGTGATTTGGG + Intronic
1137787012 16:51148044-51148066 TACCAAGTTTAGAGTGTTTCTGG + Intronic
1137855356 16:51789466-51789488 GACCCAGGATTGGGTTTTGCTGG - Intergenic
1138401118 16:56745179-56745201 GAGTCAGCCTTGAGTGTTTCTGG + Intronic
1140779301 16:78279885-78279907 GACCCAGGTGTGAGTGCATAGGG + Intronic
1142578441 17:925094-925116 GTCTCAGGTTTGACTGTCTCAGG + Intronic
1142798401 17:2327324-2327346 GTCCCAGGTTCAAGTGATTCTGG - Intronic
1146201090 17:30859448-30859470 CTCCCAGATTTGAGTGATTCTGG + Intronic
1148503983 17:48113044-48113066 AACCTATTTTTGAGTGTTTCTGG + Intronic
1150008101 17:61482103-61482125 GACCCAGGCCTGAGGGTTTGGGG - Intronic
1150578880 17:66454428-66454450 AACCCAGATTTGGGTGTTTAGGG + Intronic
1152854381 17:82655830-82655852 GACCCAGGCTTGGGGGTGTCTGG - Exonic
1156661087 18:39347518-39347540 GACCCAGGTTACCTTGTTTCAGG + Intergenic
1158245003 18:55422448-55422470 GACCCAAGTATGAGAATTTCTGG - Intronic
1159100422 18:63951873-63951895 CACTGAGGTTTGATTGTTTCTGG + Intronic
1161686386 19:5704687-5704709 GCCCCAGGTTTGAGGGCCTCAGG - Intronic
1162056333 19:8066194-8066216 GGCCCAGGTGTGAGAGGTTCAGG + Exonic
1162836253 19:13320131-13320153 GACACATCTTTGAGAGTTTCAGG - Intronic
1163536162 19:17877855-17877877 GGCCAAGCTGTGAGTGTTTCGGG + Exonic
1164488873 19:28688410-28688432 GGACCAGGTTTGAATCTTTCTGG - Intergenic
1164567439 19:29337398-29337420 TACCCTGATTTGAGTGTTCCAGG + Intergenic
1168453691 19:56487391-56487413 AACCAAGGTTTGAGTTTTACAGG - Intergenic
926476797 2:13332626-13332648 TACCCAGGTTTCATTGTTTCTGG - Intergenic
926698360 2:15785979-15786001 GAAGCGGGTTTGAGAGTTTCAGG + Intergenic
928347749 2:30516859-30516881 GACTCAGGTGTGAGGCTTTCTGG + Intronic
932971582 2:76549690-76549712 GACCAAGTTTTGACTGTTTGGGG + Intergenic
933697407 2:85229966-85229988 CACCCAGGCTGGAGTGTTACTGG - Intronic
936719380 2:115232171-115232193 GACCCAGGCTAGAATGTTACAGG - Intronic
937090820 2:119205187-119205209 GACGCAGGTTTGTGTGTACCTGG - Intergenic
937820272 2:126302676-126302698 GGCCCATGTTTGAGAGCTTCAGG + Intergenic
937854647 2:126663525-126663547 GGCCCAGGTATGAGTGGTTGAGG - Intronic
939940914 2:148350045-148350067 GACACAGGTTTGATTCTTCCTGG + Intronic
940572733 2:155460813-155460835 GACCCATGTTGGAATTTTTCTGG + Intergenic
941913414 2:170789324-170789346 GACCCATGCTTGAGTATTTACGG - Intronic
944541425 2:200757338-200757360 GACATATGTCTGAGTGTTTCAGG - Intergenic
944545152 2:200791598-200791620 GACCAAGGTTTAAATGTCTCAGG - Intergenic
945102371 2:206274400-206274422 GACCAAGGTTTTAGCGTTTGAGG - Intergenic
945196438 2:207241438-207241460 GTGCCAGGTTTGAGTGATTTTGG - Intergenic
946705289 2:222452627-222452649 GCACCAGGTCTGAGTGTTCCAGG + Intronic
948702929 2:239771812-239771834 GACCCAGGTATCGTTGTTTCTGG - Intronic
1168915357 20:1480896-1480918 GACATAGGTTTGTGTGTTGCGGG + Intronic
1170750181 20:19138426-19138448 GACCCAGGTTGGAGAGGATCAGG - Intergenic
1171987466 20:31670548-31670570 CACCCAGGAATGACTGTTTCTGG - Intronic
1172400263 20:34644721-34644743 GACACAGGTTTGAGGCTTTCAGG - Intronic
1172943960 20:38674038-38674060 GGTCCAGCTTTGAATGTTTCCGG - Intergenic
1177263892 21:18759633-18759655 GACCCAGGTGTGAGGCTATCTGG - Intergenic
1178063042 21:28873133-28873155 GAAACGGGTTAGAGTGTTTCTGG - Exonic
1178456009 21:32752253-32752275 TCCCCAGATTTTAGTGTTTCAGG + Intronic
950077643 3:10198496-10198518 GTCCCAGGTTTGACTGTTGTTGG + Intronic
953018713 3:39100514-39100536 GCCCCTGGATTGAATGTTTCTGG - Intronic
954315431 3:49798875-49798897 GCCCCAGGTGTGACTGTCTCTGG + Exonic
960538809 3:118842822-118842844 GACACAGGTATGAGGCTTTCTGG + Intergenic
964562679 3:158015281-158015303 GACCAAGGTATGAGCTTTTCAGG - Intergenic
967174798 3:186853266-186853288 GATCCAGGTAAGAATGTTTCTGG + Exonic
969070914 4:4538116-4538138 GACCCATGTTTGTTTGTTTGTGG - Intronic
969644754 4:8421279-8421301 GACTCAGGTGTGAGGCTTTCTGG + Intronic
973164216 4:47056610-47056632 GGCCCAGGCTTGAGTCTTTCAGG - Intronic
975543538 4:75538208-75538230 GACACTTTTTTGAGTGTTTCAGG - Intronic
975674574 4:76813185-76813207 AAACCAGGTTTGAGTGAATCTGG - Intergenic
981093678 4:140757318-140757340 TGCCCTGGTTTGTGTGTTTCTGG - Intergenic
983667350 4:170196417-170196439 GACCCAGGTGTGAGGCTCTCTGG - Intergenic
986190230 5:5490367-5490389 TACCCAGCTTTGAGTATTTACGG + Intergenic
996814524 5:127560169-127560191 GCCCCAGGTTTCAGGGTTTCAGG - Intergenic
1001233689 5:170011591-170011613 AACCCAGGATTCAGTGTTTTAGG + Intronic
1002600508 5:180352006-180352028 GAGCCACCTTTGGGTGTTTCTGG - Intronic
1003185224 6:3824728-3824750 GACCCAGATATGAGGGTTGCAGG - Intergenic
1010893111 6:81337884-81337906 GACCCAGGTGTGAGGCTATCTGG + Intergenic
1014960206 6:127673898-127673920 AACTCAGGTTTGAGTGTTATCGG - Intergenic
1020957842 7:14764445-14764467 GATCCAGGTTTGAGTATTACTGG - Intronic
1021459158 7:20866068-20866090 AACCCAGGTTGGAGTCTTCCTGG + Intergenic
1022312800 7:29212957-29212979 GCACCAGGTCTGAGTGTTCCAGG - Intronic
1023636261 7:42213924-42213946 TACCCATGTTTAAGGGTTTCTGG - Intronic
1023777309 7:43620140-43620162 GATCCATGGTTGAGTGCTTCTGG + Intronic
1025853877 7:65262281-65262303 GACCCTGGTCTGGGTGTCTCAGG - Intergenic
1026872328 7:73860687-73860709 CACCCAGGCTTGAGTGATCCTGG + Intergenic
1027595572 7:80169544-80169566 TAACCAGGTGTTAGTGTTTCAGG + Intronic
1034380929 7:150691735-150691757 GATCCAGGACTGAGTGATTCAGG + Intronic
1035386895 7:158479046-158479068 GACCCACGAGTGAGTGTTTCGGG + Intronic
1035733384 8:1869244-1869266 GAACCAGGTTTGATTTTGTCTGG + Exonic
1038613713 8:29074580-29074602 GAGGCAGGTTTGAGTGTCCCTGG - Intronic
1039162298 8:34635613-34635635 AACCCAGGTTAGAGTGTTCATGG - Intergenic
1039693464 8:39884777-39884799 GACACAGGTTTCAGGCTTTCTGG - Intergenic
1040880277 8:52197485-52197507 GGCCCTGGTTTGAGTGCTTCTGG - Intronic
1041452534 8:58021978-58022000 GAGCCAGTGTTGAGAGTTTCTGG + Intronic
1042480296 8:69295130-69295152 GACCCAGGTCTGAGAGTTGCAGG + Intergenic
1043864485 8:85359849-85359871 GACTCAGGTTTCAGGGTATCTGG - Intronic
1045047316 8:98291874-98291896 GACAAAGGTGTGAGTGCTTCTGG - Intronic
1045381287 8:101629597-101629619 GACCCAACTTGGGGTGTTTCTGG + Intronic
1045680846 8:104658294-104658316 GACCCAGCTTTGGGTCTTCCTGG - Intronic
1047808391 8:128381724-128381746 GACACAGGTGTGAGGCTTTCTGG - Intergenic
1051574381 9:18598324-18598346 GACCCAGGTTTGAGTGTTTCTGG - Intronic
1052532107 9:29699624-29699646 TAGCCAGGTTAGAGTGATTCTGG + Intergenic
1056704324 9:88939309-88939331 GCCTCAGGTTTGAGGGTTCCTGG + Intergenic
1057877236 9:98767408-98767430 TACCCAGGTTTGAGGGCATCAGG - Intronic
1058223333 9:102329309-102329331 GACCAAGGTTTGATTGAATCTGG - Intergenic
1187244445 X:17541288-17541310 GAGCCAGGTTTGAATGTGACTGG + Intronic
1187528526 X:20075501-20075523 GAGCCATGTTGGACTGTTTCTGG + Intronic
1190541140 X:51480242-51480264 GACACAGGTGTCAGGGTTTCTGG + Intergenic
1190863338 X:54363843-54363865 GACCCAGGTTTTATTGTTTTAGG - Intergenic
1191873756 X:65772970-65772992 GCACCAGGTCTGAGTGTTCCAGG + Intergenic
1195297305 X:103491517-103491539 GAAACAGATTTGAGTGTTGCTGG + Intergenic
1198915765 X:141669929-141669951 CAGCCAGGTTTCAGTTTTTCTGG - Intronic
1199055029 X:143283879-143283901 GACACAGGTTTGTTTTTTTCAGG - Intergenic
1201472067 Y:14344522-14344544 GACACAGGTATGAGGCTTTCTGG - Intergenic