ID: 1051576093

View in Genome Browser
Species Human (GRCh38)
Location 9:18617252-18617274
Sequence TGTTCTCCAAATTATTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051576091_1051576093 30 Left 1051576091 9:18617199-18617221 CCTAAGAATGTCAGTCTGAGGCA 0: 1
1: 0
2: 0
3: 7
4: 173
Right 1051576093 9:18617252-18617274 TGTTCTCCAAATTATTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051576093 Original CRISPR TGTTCTCCAAATTATTAGCA TGG Intronic
No off target data available for this crispr