ID: 1051580402

View in Genome Browser
Species Human (GRCh38)
Location 9:18667121-18667143
Sequence CTGAATTCCTTGAGGGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 5, 3: 26, 4: 284}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051580402_1051580411 23 Left 1051580402 9:18667121-18667143 CCCCCTTCCCTCAAGGAATTCAG 0: 1
1: 0
2: 5
3: 26
4: 284
Right 1051580411 9:18667167-18667189 CAAACTTGTATACCCCCAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051580402 Original CRISPR CTGAATTCCTTGAGGGAAGG GGG (reversed) Intronic
900179343 1:1304463-1304485 CTGAACTCCTAGAGGAGAGGCGG - Intronic
900798961 1:4726077-4726099 CTGGAGTCCTTGCGGGATGGGGG + Intronic
901755092 1:11436707-11436729 CTGAGTTCCTTGGGGGAAGGTGG + Intergenic
901817382 1:11802619-11802641 CTGTATTCTTTGAGGGAACTTGG - Intronic
905370252 1:37479241-37479263 CTGGATTTCCTGAGGGATGGGGG - Intronic
907264278 1:53246981-53247003 CTGAATTCCATGAGGCACGAAGG + Exonic
907358144 1:53893265-53893287 ATGACTTCCTTGAGAGAAGAGGG + Intronic
910170263 1:84369605-84369627 TTGAATGCCTTGAGGGAGAGGGG - Intronic
913324413 1:117614223-117614245 TTGAATTCCTTGGGGGATGAAGG - Intronic
915499109 1:156302210-156302232 CAGAATTCCTTGAGCCCAGGAGG - Intergenic
916444555 1:164860202-164860224 CTGCATGACTTGGGGGAAGGTGG - Intronic
916452444 1:164933978-164934000 CTGAGTTCCTTGAGAGATGGAGG - Intergenic
916477600 1:165185255-165185277 CTGAATTAGTTGAGGGCAGTAGG - Intergenic
920048978 1:203151970-203151992 CGGAACTCCTTGTGGGGAGGAGG - Intronic
920190323 1:204189722-204189744 CTGGCTCCCTGGAGGGAAGGGGG + Intergenic
920356344 1:205376033-205376055 CTGAATCCCTTGAGGGACTTGGG - Intergenic
920928031 1:210361196-210361218 CTGAATTCATTAAGGCAAAGAGG - Intronic
923218328 1:231870524-231870546 CTGAGCTCGTTGTGGGAAGGCGG + Intronic
1063937420 10:11092732-11092754 GTGAATTGCTTCAGGGAAGAAGG + Intronic
1064103751 10:12484445-12484467 CTGCCTTCCTGCAGGGAAGGAGG - Intronic
1064641755 10:17422336-17422358 CTTAATTACTTGTGGGAGGGGGG - Intronic
1064709588 10:18109787-18109809 CTCAAACCCCTGAGGGAAGGGGG - Intergenic
1065579365 10:27155511-27155533 CTGAATTCCTCAATGGAGGGCGG - Exonic
1066253394 10:33655565-33655587 CTGGAGTTCTTGAGGAAAGGAGG - Intergenic
1069065850 10:63941317-63941339 CTGAATTTGTTGAGGGTAGGAGG - Intergenic
1072095884 10:92179168-92179190 CTCCAATCCTTGAGAGAAGGGGG - Intronic
1072608387 10:97001579-97001601 CTGAACTGCTGGAGGGAGGGGGG + Intronic
1075381679 10:122023934-122023956 GTGATTGCCTTGTGGGAAGGTGG + Intronic
1076238311 10:128882982-128883004 CAGAATTCCATCATGGAAGGAGG + Intergenic
1076769687 10:132656221-132656243 AGGAACTCCTAGAGGGAAGGTGG + Intronic
1077085754 11:749563-749585 CTTAACTCCTTGTGGGAGGGAGG + Intronic
1077949722 11:6943197-6943219 CTGAATTCATTGCGTAAAGGTGG + Exonic
1083056798 11:59829595-59829617 CTGCATCCCTTGGGGGATGGAGG - Intronic
1086854077 11:91845718-91845740 TTGAATTCCTTTAGGGATGAAGG - Intergenic
1087227961 11:95625408-95625430 CTGAATTGTTAGAGGCAAGGTGG + Intergenic
1088490113 11:110378699-110378721 CAGATTTCCCTGAGAGAAGGAGG - Intergenic
1089577266 11:119454012-119454034 CTTACTTCCTTCAGGGAGGGTGG + Intergenic
1091148870 11:133307104-133307126 TGAAATTCCATGAGGGAAGGAGG - Intronic
1092280966 12:7097370-7097392 CAGAATTGCTTGAGCGCAGGAGG - Intronic
1093623747 12:21322710-21322732 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1094007321 12:25769210-25769232 CTGAATTTCTTGAGAGTATGAGG + Intergenic
1096436561 12:51595722-51595744 CTAAATCCCTAGAGGCAAGGGGG - Intronic
1096682149 12:53262986-53263008 CTGAATTGCTTGAGCCCAGGAGG + Intergenic
1096790381 12:54040756-54040778 CTGATTTTCATGAGGGCAGGTGG + Intronic
1096867240 12:54571912-54571934 CTGAATCTCTTGAGGCTAGGAGG - Intronic
1097534408 12:60848220-60848242 TTGCCTTCCTTGTGGGAAGGCGG - Intergenic
1098321957 12:69254811-69254833 CTAAATTATTTGAGGGAGGGAGG - Intronic
1100258166 12:92905156-92905178 TGGAATTCCTTGAGTGATGGAGG - Intronic
1100349377 12:93764315-93764337 CAGAGTTGCTGGAGGGAAGGGGG + Intronic
1102644274 12:114393762-114393784 CTGCATTGCTTGGGAGAAGGTGG - Intronic
1105414674 13:20199688-20199710 CTGATTTCTGTGTGGGAAGGTGG + Intergenic
1106112492 13:26789298-26789320 CTGAATTTAGTGAGGCAAGGAGG - Intergenic
1106398296 13:29403048-29403070 CTGAACTTCAGGAGGGAAGGAGG + Intronic
1106755505 13:32819353-32819375 CAGAATTGCTTGATGGGAGGCGG - Intergenic
1106849171 13:33770473-33770495 CTGAACTGCTTCAGGGGAGGAGG - Intergenic
1107258312 13:38457809-38457831 CTGATTTCCCTGAAGGAAAGTGG - Intergenic
1107274499 13:38662913-38662935 CTCAAGTCCTTGAGTGATGGTGG - Intergenic
1108449282 13:50544821-50544843 CTGAAGTCCTTGAAGGAACTGGG + Intronic
1108815681 13:54287277-54287299 TTGAGCTCCTTGGGGGAAGGAGG - Intergenic
1110317852 13:74132115-74132137 CTTTTTTCCTTGAGGGAGGGGGG + Intronic
1110455240 13:75684026-75684048 CTGAATTCCAAAAGGGAGGGGGG + Intronic
1110811003 13:79810297-79810319 CTGAATCCCATGAGGGTGGGGGG - Intergenic
1112250141 13:97771741-97771763 CAGAATCCCTTGAATGAAGGGGG - Intergenic
1112595708 13:100805138-100805160 CTGGATCCCTGGAGGGATGGAGG - Intergenic
1113346146 13:109480356-109480378 CTGATATCCTCTAGGGAAGGAGG + Intergenic
1113842226 13:113366593-113366615 CTGAATTCCTGAAGGGAGGAGGG - Intergenic
1114441617 14:22752795-22752817 CTGAATTCCAAAAGGGAAGAGGG + Intergenic
1115307578 14:31948212-31948234 ATGATTGCCTTGAGGGAAGGAGG + Intronic
1115351906 14:32404912-32404934 CTGTATTCCAGGAGGGAGGGAGG + Intronic
1115892683 14:38049374-38049396 CTGAGTTTCTTGAGGGAATGAGG + Intergenic
1118756240 14:68846027-68846049 GAGAATTCCTTGAGCCAAGGAGG - Intergenic
1119119690 14:72063126-72063148 ATGAAATTCTTGAGGAAAGGAGG + Intronic
1119515020 14:75241063-75241085 CTGAATTCCCTGACCCAAGGTGG - Intronic
1121406635 14:93723069-93723091 CTGAACAACTTGAGGGAGGGAGG - Intronic
1122859182 14:104574813-104574835 CTGAACTCCCGCAGGGAAGGGGG + Intronic
1202840993 14_GL000009v2_random:121160-121182 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202910378 14_GL000194v1_random:111388-111410 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202882201 14_KI270722v1_random:71108-71130 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1124491825 15:30162854-30162876 GTAAATTCCATGAGGGAAGCAGG - Intergenic
1124751711 15:32375463-32375485 GTAAATTCCATGAGGGAAGCAGG + Intergenic
1126675758 15:51158212-51158234 CAGAAATCCATGAGGGAAGCAGG - Intergenic
1126845066 15:52751762-52751784 CTGAATTGCTTCAAGGCAGGGGG - Intergenic
1127261376 15:57329147-57329169 TTGATTTCCTTTAAGGAAGGTGG - Intergenic
1127595828 15:60481099-60481121 CGGAATTCATTGAAGGGAGGAGG + Intergenic
1128290582 15:66475549-66475571 CTGAATTCCCTAAGGCAAGATGG - Intronic
1130103168 15:80909314-80909336 CAGAGTTCCCTGAGGGAAGGAGG - Intronic
1130332520 15:82933314-82933336 CAGAATTCCTTGAGCCCAGGAGG - Intronic
1131029675 15:89176007-89176029 CTGAAGGCCCTGATGGAAGGCGG - Intronic
1131821303 15:96277333-96277355 TTGAGTTCCTTAAGGGCAGGAGG - Intergenic
1131949060 15:97661028-97661050 CATAATTCCATGATGGAAGGTGG - Intergenic
1133220520 16:4317391-4317413 CTGGCATCCTGGAGGGAAGGTGG + Intronic
1133824770 16:9268220-9268242 GTGAATTCCTTGATGGATGAAGG + Intergenic
1133931000 16:10232021-10232043 CTGCATTCCTTGAGTGATGAAGG + Intergenic
1134411108 16:14003787-14003809 CTGCATTTCATGAGGGAATGAGG + Intergenic
1137033952 16:35552893-35552915 CTGAACTCCTTATTGGAAGGCGG - Intergenic
1138272015 16:55702198-55702220 CTGAGGTCCGTGAAGGAAGGGGG + Intronic
1140418597 16:74797020-74797042 TTGAATTCCCAGAGGGAGGGAGG + Intergenic
1145127426 17:20313904-20313926 CTGAAGTCCTTGAGGGGAAGGGG + Intronic
1145974676 17:28977338-28977360 CTGAAGTCATGGAGGGGAGGCGG - Intronic
1146080037 17:29771607-29771629 CTGAATTCTGTGTGTGAAGGAGG - Intronic
1146280865 17:31543459-31543481 CTGGATTCCTTCTGGGATGGGGG - Intergenic
1146833056 17:36086621-36086643 CTGATTTCTTTGAGGAAATGAGG - Intergenic
1147439634 17:40440088-40440110 GTGAGCTCCTTGAGGGCAGGGGG + Intergenic
1147607402 17:41782035-41782057 CTGGATTCCCTGAGGGCAGGCGG - Intronic
1148859131 17:50594978-50595000 CTGATTTCCTACAGGGAAAGGGG - Exonic
1149518966 17:57303958-57303980 CTGAATTACTAGAGGGAGGAGGG + Intronic
1150011240 17:61506121-61506143 CTGGTATCCTTGAGGAAAGGGGG - Intergenic
1153887111 18:9476362-9476384 CAGAATTACTTCAGGGAAGACGG - Intronic
1154966460 18:21362283-21362305 TTGAATTACTTGTGGGGAGGAGG - Intronic
1156600266 18:38597563-38597585 CTGAATTCCTGGAGGACAAGAGG - Intergenic
1157952387 18:52054084-52054106 CTGAGCTCCTTGATGGCAGGCGG + Intergenic
1158220427 18:55145129-55145151 CTGAGTTCCTGGAGCAAAGGTGG - Intergenic
1159439416 18:68457993-68458015 CTGAATTGCTTGAGCCCAGGAGG + Intergenic
1160365839 18:78325247-78325269 CTGAGTTCCTGGAATGAAGGTGG - Intergenic
1161433532 19:4248356-4248378 ACGCATTCCTTGAGGCAAGGGGG - Intronic
1161837290 19:6656521-6656543 CTTAAGTCCTTGAGGAAGGGGGG + Intergenic
1161838125 19:6661602-6661624 CTTAAGTCCTTGAGGAAGGGGGG + Intronic
1161917542 19:7240480-7240502 CAGAATTGCTTGAGGCAAGGCGG + Intronic
1162660909 19:12168506-12168528 CTCAAGTCCTGTAGGGAAGGGGG + Intronic
1164286525 19:23822189-23822211 CTGCAATGATTGAGGGAAGGTGG - Intronic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1164829450 19:31309321-31309343 CGGAATTCCTTGCCTGAAGGAGG + Intronic
1165569856 19:36766628-36766650 TTAAATTCCTTTAAGGAAGGGGG + Intronic
1165890103 19:39106845-39106867 CTGTCTTCCTTGAGGGCAGCAGG + Intronic
1167112477 19:47470455-47470477 CTGCCTTCCTTGAGAGAAGGGGG - Intronic
1168622085 19:57887679-57887701 GTTAACTCCTTGAGGAAAGGGGG - Intronic
1202631318 1_KI270706v1_random:2610-2632 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1202657811 1_KI270708v1_random:40206-40228 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
925947833 2:8882214-8882236 CTGAGTTCCTTGAAGACAGGAGG - Intronic
926750266 2:16193374-16193396 CTTATTTCCTTCAGGGAAGTGGG + Intergenic
928621512 2:33092914-33092936 ATCAGTTCCTTGAGGGCAGGTGG - Intronic
932162021 2:69469270-69469292 CAGAATTCCTTAAGGGAATGTGG - Exonic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
932605633 2:73163568-73163590 TACAACTCCTTGAGGGAAGGAGG + Intergenic
933817903 2:86083161-86083183 CTCAATTCCTGGAGCCAAGGAGG + Exonic
936648825 2:114403036-114403058 CAGACTTCCTTGAGGGTGGGTGG + Intergenic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
937239246 2:120449735-120449757 CTGAAGTCCTTGATGCAAGAAGG + Intergenic
937831585 2:126430229-126430251 CTCAAGTCCTTGAGGTGAGGAGG + Intergenic
938421653 2:131151761-131151783 GTGAATGGCTGGAGGGAAGGGGG + Intronic
939519939 2:143217503-143217525 CTGAACTCTTCAAGGGAAGGTGG - Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
940465854 2:154025806-154025828 CTCAATTCTTTGAGGGAAAGGGG + Intronic
940999884 2:160190534-160190556 CTGAAATCCTTTGGGGAAGCAGG - Intronic
941045593 2:160671759-160671781 GTGCAGTACTTGAGGGAAGGTGG + Intergenic
944587750 2:201187371-201187393 CTGAATTTCTTGATGGAATCAGG + Intronic
945518400 2:210792216-210792238 CTGAAGTCAGTGGGGGAAGGCGG - Intergenic
946153760 2:217793770-217793792 CAGAATCCCCTGAGGGAGGGAGG + Intergenic
946321175 2:218955406-218955428 CTGCTTTCCTTGATGGAAGGGGG - Intergenic
946421854 2:219569872-219569894 GTGAATTCAGTGGGGGAAGGAGG + Intronic
946863916 2:224025593-224025615 CTAAATTGCTTCATGGAAGGTGG - Intronic
947098346 2:226592031-226592053 CTGAATTCCCGGAGGAAGGGGGG - Intergenic
1168824580 20:801285-801307 CTCAAACCCCTGAGGGAAGGGGG - Intergenic
1168854294 20:997991-998013 CTGCAGTCCAAGAGGGAAGGGGG - Intronic
1168880378 20:1201435-1201457 CTGAAGTTCTTGGGGGAAGGGGG + Intergenic
1169218450 20:3806769-3806791 CCCAATTTCTTGAGGGAATGAGG - Intergenic
1169304597 20:4477582-4477604 CTGCATTGCATCAGGGAAGGTGG - Intergenic
1171464810 20:25320000-25320022 CTGAAGGGGTTGAGGGAAGGCGG - Intronic
1172105199 20:32513038-32513060 CTGAAGTCCTTGGAAGAAGGAGG - Intronic
1172329166 20:34062700-34062722 CTGACTTCCCTGTGGGAAAGAGG + Intronic
1173469027 20:43308323-43308345 CTGAACTTCTTAAGGGGAGGAGG + Intergenic
1174076229 20:47939285-47939307 CAGAATGCCTTGAGGGCAAGGGG - Intergenic
1175497887 20:59427285-59427307 CTGAACTCCTTCATGGAAGGTGG - Intergenic
1176049215 20:63107828-63107850 TTGTTTTACTTGAGGGAAGGTGG + Intergenic
1176597702 21:8762548-8762570 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1176629734 21:9126089-9126111 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1176643537 21:9328550-9328572 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1178513101 21:33223542-33223564 CTGAATTCCACAAGGGAAGAGGG + Intergenic
1180369396 22:11970671-11970693 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1180376835 22:12101444-12101466 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1180420738 22:12812248-12812270 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1182058820 22:27382205-27382227 CTGGATTCCTTTAGGGTAGAAGG + Intergenic
1182320331 22:29474858-29474880 CTGGTTGTCTTGAGGGAAGGAGG - Intergenic
1182932119 22:34184427-34184449 CTAAAATCCTTGAGGGATGAAGG + Intergenic
1184316689 22:43698724-43698746 CTGAGTTCCCTGAGGAAAGGTGG + Intronic
1184711382 22:46251099-46251121 CTCAAATCTTTGGGGGAAGGAGG - Intergenic
949227557 3:1712295-1712317 CTGAATTCCACAAGGGGAGGAGG - Intergenic
949969593 3:9393477-9393499 CTGAATTCTTTTGGGGAAGGTGG - Intergenic
951586761 3:24222632-24222654 CCAAATTCCTTGAGGGCAGAAGG - Intronic
952155078 3:30634492-30634514 TTTAAACCCTTGAGGGAAGGGGG - Intronic
952421036 3:33131698-33131720 CTACATTGCTTGAGGGCAGGTGG + Intronic
953502960 3:43455501-43455523 CTTAAGTCCTTGAGGAATGGGGG + Intronic
953586388 3:44204993-44205015 CTCAATGCCTTGTGGGAAGTAGG - Intergenic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
953991754 3:47489316-47489338 GAGAATTCCTTGAGGCCAGGAGG - Intergenic
954199432 3:49015373-49015395 CAGCATGCCTTGAGGGGAGGAGG + Exonic
955949195 3:64225114-64225136 CTGTTTTCCCTGAGGGAATGTGG - Exonic
956929652 3:74028603-74028625 CAGCATCCCTAGAGGGAAGGTGG + Intergenic
960060150 3:113312373-113312395 CTGAATTCCTTTAGGCTGGGCGG - Intronic
962482522 3:135810009-135810031 CTCAAACCCCTGAGGGAAGGGGG + Intergenic
962940006 3:140117148-140117170 CTAACTGCCCTGAGGGAAGGAGG - Intronic
963311345 3:143713596-143713618 TTAAATTTCTTCAGGGAAGGAGG - Intronic
965514031 3:169601426-169601448 CTCTATTCCTTGTGGGAATGAGG - Intronic
966513558 3:180791806-180791828 CTGAACTACTTGAGAGTAGGCGG - Intronic
966679272 3:182623825-182623847 CAGAATTCCTTGAGCCCAGGAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967741734 3:193010480-193010502 CTGTGTTCCTGGAGGGAATGTGG + Intergenic
967817891 3:193814696-193814718 CTGATTTGCTTCAGGGAAAGGGG + Intergenic
1202743345 3_GL000221v1_random:76479-76501 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
968444788 4:646379-646401 CTGAAAACCTCGAGGGAAGCTGG - Intronic
969415303 4:7053920-7053942 CTGAATGCCTTTGGGGAGGGTGG + Intronic
969633491 4:8352120-8352142 CTGAATTCTTTCAAGCAAGGAGG - Intergenic
973240850 4:47954451-47954473 CTCAAACCCCTGAGGGAAGGGGG - Intronic
973361004 4:49164802-49164824 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
975193537 4:71495053-71495075 CTGAAGTCCTTAATGAAAGGTGG + Intronic
976380465 4:84392896-84392918 CTAAATTCCCTGAGGCAAGTAGG - Intergenic
978211606 4:106144091-106144113 CTGAAATCCTTTATGGAAAGAGG - Intronic
980211628 4:129795733-129795755 ATAAATTTCTTGAGGGCAGGAGG - Intergenic
981510572 4:145552992-145553014 CAGGATTGCTTGAGGCAAGGAGG - Intronic
981800601 4:148650933-148650955 CTAAGTTCCATGAGGGGAGGAGG + Intergenic
988679983 5:33475524-33475546 CTCATTTACTGGAGGGAAGGAGG - Intergenic
988731375 5:33976355-33976377 ATAAACTTCTTGAGGGAAGGGGG - Intronic
989774091 5:45181989-45182011 CCGAAGTCCTGGTGGGAAGGTGG - Intergenic
990698803 5:58452797-58452819 GTGACTTCCTTGAGGGCAGGGGG + Intergenic
991602573 5:68368204-68368226 CTGAATTCCTTGAGGGGTGGTGG - Intergenic
992125653 5:73637319-73637341 CTAAGTTTCTTGAGAGAAGGAGG - Intronic
992460788 5:76957932-76957954 GTGAATCCCTTGAGGTCAGGAGG + Intronic
992936088 5:81706844-81706866 CTGAAGTCCTCTAGGGAAGTGGG + Intronic
993145386 5:84086904-84086926 CTGAGTTCCTGGAAGGATGGAGG + Intronic
993467961 5:88270597-88270619 CAGAATACCTGGAGGGAAGGTGG + Intergenic
993539322 5:89128979-89129001 CAGATTACCTTGAGGGAAAGTGG - Intergenic
996492238 5:124111383-124111405 CTGAACTCCTTCAGTGAATGAGG - Intergenic
996675668 5:126172100-126172122 CTGAATTCTTTGTGGGAGGGTGG + Intergenic
997685218 5:135783727-135783749 CTTAATTTCCAGAGGGAAGGAGG + Intergenic
998557722 5:143141935-143141957 CTGAATTTCATGAGAGAATGGGG - Intronic
999267872 5:150278689-150278711 CTGAATTCCTCGAGGGGTGTAGG + Intronic
999651390 5:153770784-153770806 CTGAATTCTTTGACAGAAGGTGG + Intronic
1000130261 5:158290416-158290438 CAGCATTGCTTTAGGGAAGGGGG + Intergenic
1001591848 5:172870992-172871014 GTGAATTCCTCAAGGGCAGGAGG - Intronic
1002496131 5:179612852-179612874 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1003223253 6:4180590-4180612 CTGAATTCATTCAGGGCAGATGG + Intergenic
1003534930 6:6968610-6968632 CTGAAATCCTCCAGTGAAGGAGG - Intergenic
1003770264 6:9291353-9291375 CTGAATTTATTGAGGGAAGGGGG - Intergenic
1006051673 6:31350145-31350167 CTGAATTCCAAGAGGGAAGAGGG + Intronic
1006557029 6:34875961-34875983 CTGAAGTCTTTGAGGGACAGTGG - Exonic
1007301682 6:40872416-40872438 CTGCATTCACTGAGGCAAGGAGG - Intergenic
1008543025 6:52562212-52562234 GTGCATTCTTTGAGGGCAGGAGG - Intronic
1008591140 6:52994973-52994995 CTGAATGCATTGGTGGAAGGTGG - Intronic
1008730264 6:54473579-54473601 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1012063111 6:94512062-94512084 CTGAGCCCCTGGAGGGAAGGGGG + Intergenic
1014692995 6:124584961-124584983 CTGATTCCCTTTAGGGGAGGGGG - Intronic
1014736875 6:125104118-125104140 GTGATTTGCTTGAGGGAAGGGGG - Intergenic
1017237262 6:152129782-152129804 CTGAATTCCTGGAAGGAGGGTGG - Intronic
1017837758 6:158194653-158194675 GTTAACTCCTTGAGGAAAGGGGG + Exonic
1018299418 6:162385177-162385199 CTCAATTCCTTGAGGGAATGGGG - Intronic
1020083287 7:5297699-5297721 CTGGTTTCCCTGAGGGAATGTGG + Intronic
1020808436 7:12820908-12820930 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1021099397 7:16571309-16571331 CTGAATTCCAAAAGGGAGGGGGG - Intronic
1022551914 7:31248783-31248805 CTGATTTGCATGAGGAAAGGGGG + Intergenic
1022985448 7:35649861-35649883 CTGAATTCCAAAAGGGAAGAGGG + Intronic
1023098457 7:36687818-36687840 CAGGATTCCTTGAGGGAAGGTGG + Intronic
1028370170 7:90082917-90082939 GTGGATTCCTTGAAGGAAGTAGG + Intergenic
1030124638 7:106142199-106142221 CTGATTTCCTAAAGGGAAAGTGG + Intergenic
1030675906 7:112385035-112385057 CCCAATTCCCTGAGGGTAGGAGG + Intergenic
1030971893 7:116067851-116067873 TTAAATTCCTTGATGGAAGAGGG + Intronic
1031460240 7:122039771-122039793 GTGAATTACTTGAGGTCAGGAGG + Intronic
1031863207 7:127007024-127007046 CTGGGATCCTTGATGGAAGGTGG + Intronic
1032628339 7:133618603-133618625 CTGAATTCAGTGAAGGACGGAGG + Intronic
1033219122 7:139516462-139516484 CTGAAATCCTGTAGGAAAGGAGG - Intergenic
1033296017 7:140136426-140136448 TTGAATTTCTTAAAGGAAGGAGG + Intronic
1033353973 7:140584661-140584683 CTGAATGCCCAGAGGGCAGGGGG - Intronic
1034269773 7:149797875-149797897 CTGAGCTCCTTGAGGGCAGTGGG + Intergenic
1034617239 7:152429026-152429048 ATGAAATTATTGAGGGAAGGAGG - Intronic
1037182561 8:16025066-16025088 CTGTATGCAATGAGGGAAGGTGG + Intergenic
1037671387 8:21018159-21018181 GGTAATTCCTGGAGGGAAGGGGG - Intergenic
1037998913 8:23373869-23373891 CTGAAGCCCTTGGGGGATGGGGG - Intronic
1038175787 8:25181434-25181456 CTGAATTTCTTCAGCTAAGGAGG + Intergenic
1038881877 8:31623576-31623598 CTCAAGTCCATGAGGGAAGTAGG - Intergenic
1039001300 8:32983293-32983315 TTGAATTGCTTTAGGGAGGGAGG - Intergenic
1041434614 8:57824737-57824759 CTGAATTCCTTCAGGCATTGAGG + Intergenic
1042933487 8:74035610-74035632 CTGAATTCCAAAAGGGAAGAGGG - Intergenic
1044653774 8:94525915-94525937 CTGACTTGCTTCTGGGAAGGTGG - Intronic
1046547079 8:115667236-115667258 CTGACTTCCCTGGGGAAAGGGGG + Intronic
1047131700 8:122027894-122027916 CTGAATACCTAGAGGGCATGAGG - Intergenic
1047722984 8:127659423-127659445 CTGATTTCCCTGAAGGAAGAAGG - Intergenic
1047766700 8:127996048-127996070 CAGAGGTCCTTGAGGGAGGGAGG - Intergenic
1048955924 8:139535942-139535964 CTGTATTCCTCGACTGAAGGTGG + Intergenic
1049467588 8:142759121-142759143 CTGAATTCCAGGAGGGAGGAGGG - Intergenic
1051580402 9:18667121-18667143 CTGAATTCCTTGAGGGAAGGGGG - Intronic
1052457517 9:28719308-28719330 ATTAGTTCCTTCAGGGAAGGAGG - Intergenic
1053594273 9:39544043-39544065 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1053852054 9:42299088-42299110 CTGAATTCCAAGAGGAAAGAGGG - Intergenic
1054571980 9:66820915-66820937 CTGAATTCCAAGAGGAAAGAGGG + Intergenic
1055237852 9:74146061-74146083 CTGATTTCCTTAACGGAATGTGG - Intergenic
1056170020 9:83975976-83975998 CTGAAATTCTTGAGGAAATGGGG + Intronic
1056508189 9:87277335-87277357 CTGAATTAAATGAGGGAGGGCGG + Intergenic
1056704399 9:88939762-88939784 TTGAAGACCTGGAGGGAAGGTGG - Intergenic
1057803130 9:98201954-98201976 CTGAATCCCTTGAGCCAAGCAGG + Intronic
1059557605 9:115297117-115297139 CTGAACTCTTTGAGAGAATGTGG - Intronic
1059947127 9:119421016-119421038 GTGAATTTCTTGAGAGCAGGGGG - Intergenic
1060955046 9:127632794-127632816 CTGCATTCCAGGAAGGAAGGAGG + Intronic
1062218561 9:135402344-135402366 GAGAATTCCAGGAGGGAAGGGGG - Intergenic
1203690042 Un_GL000214v1:33891-33913 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1203752568 Un_GL000218v1:93770-93792 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203711981 Un_KI270742v1:106443-106465 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203539222 Un_KI270743v1:71749-71771 TTAAAGTCCTTGAGGAAAGGGGG + Intergenic
1203555590 Un_KI270743v1:204771-204793 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1203646233 Un_KI270751v1:70162-70184 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1185637210 X:1561533-1561555 CTGAATTGCTTGAGCCCAGGAGG - Intergenic
1185977585 X:4738830-4738852 CTGAATTGCTGGAGCAAAGGAGG + Intergenic
1186163684 X:6804734-6804756 CTGAGTTCAATGAGTGAAGGAGG - Intergenic
1186377840 X:9026337-9026359 GTGAGTTCCTTCAGGGAAGGCGG + Intronic
1187232147 X:17433574-17433596 CTGGATGCCTAGAGGAAAGGTGG + Intronic
1188192369 X:27187844-27187866 CTGAATTCCACAAGGGAGGGGGG - Intergenic
1191990270 X:67027261-67027283 CTGCATTCCTTTGGAGAAGGAGG - Intergenic
1193224741 X:78969162-78969184 TTGCATTCCTTGGGGGAGGGGGG - Intergenic
1194585685 X:95731115-95731137 CTGGAGTCCTTGAGGTAAGCAGG + Intergenic
1195090625 X:101455047-101455069 ATGGATTTTTTGAGGGAAGGAGG + Intronic
1197343086 X:125297648-125297670 GTGAATTCTTTAAGAGAAGGAGG + Intergenic
1198982855 X:142419060-142419082 CTGAATTCCAAAAGGGAGGGGGG - Intergenic
1199525299 X:148785054-148785076 CTCACTGCCTTGGGGGAAGGGGG - Intronic
1200825146 Y:7630059-7630081 GTTAACTCCTTGAGGAAAGGGGG + Intergenic
1201166217 Y:11211382-11211404 TTAAAGTCCTTGAGGAAAGGGGG - Intergenic
1202234909 Y:22701027-22701049 GTTAACTCCTTGAGGAAAGGGGG - Intergenic
1202308250 Y:23495141-23495163 GTTAACTCCTTGAGGAAAGGGGG + Intergenic
1202562551 Y:26175445-26175467 GTTAACTCCTTGAGGAAAGGGGG - Intergenic