ID: 1051589070

View in Genome Browser
Species Human (GRCh38)
Location 9:18757671-18757693
Sequence CCTTCTACACTGAAGCCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051589064_1051589070 20 Left 1051589064 9:18757628-18757650 CCCAGCAGAGAGCCTCCCTCTTC 0: 1
1: 0
2: 2
3: 19
4: 277
Right 1051589070 9:18757671-18757693 CCTTCTACACTGAAGCCACATGG No data
1051589067_1051589070 5 Left 1051589067 9:18757643-18757665 CCCTCTTCTGCAGTGACTCTTCT 0: 1
1: 0
2: 4
3: 35
4: 348
Right 1051589070 9:18757671-18757693 CCTTCTACACTGAAGCCACATGG No data
1051589066_1051589070 8 Left 1051589066 9:18757640-18757662 CCTCCCTCTTCTGCAGTGACTCT 0: 1
1: 0
2: 2
3: 40
4: 314
Right 1051589070 9:18757671-18757693 CCTTCTACACTGAAGCCACATGG No data
1051589068_1051589070 4 Left 1051589068 9:18757644-18757666 CCTCTTCTGCAGTGACTCTTCTA 0: 1
1: 0
2: 2
3: 18
4: 204
Right 1051589070 9:18757671-18757693 CCTTCTACACTGAAGCCACATGG No data
1051589065_1051589070 19 Left 1051589065 9:18757629-18757651 CCAGCAGAGAGCCTCCCTCTTCT 0: 1
1: 0
2: 0
3: 33
4: 287
Right 1051589070 9:18757671-18757693 CCTTCTACACTGAAGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051589070 Original CRISPR CCTTCTACACTGAAGCCACA TGG Intronic
No off target data available for this crispr