ID: 1051594541

View in Genome Browser
Species Human (GRCh38)
Location 9:18811232-18811254
Sequence CTCCCCTCCATGAGGGTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 235}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051594541_1051594548 28 Left 1051594541 9:18811232-18811254 CCCCCAACCCTCATGGAGGGGAG 0: 1
1: 0
2: 1
3: 35
4: 235
Right 1051594548 9:18811283-18811305 ACACCTACCAGAGTGTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051594541 Original CRISPR CTCCCCTCCATGAGGGTTGG GGG (reversed) Intronic
900121960 1:1052059-1052081 CTCCCCACCAGGAAGGATGGAGG - Intronic
900718801 1:4161734-4161756 CCCGCCCCCATGAGGTTTGGTGG - Intergenic
901707843 1:11089710-11089732 CTGCCCTCCCAAAGGGTTGGGGG - Intronic
902479134 1:16702476-16702498 CTGCCCTCCATGGGAGCTGGGGG - Intergenic
902587097 1:17446446-17446468 CTTCTCTTCCTGAGGGTTGGAGG + Intergenic
903696434 1:25210798-25210820 CTCCCCTCCCTGAGGTCTGGGGG + Intergenic
904356085 1:29940832-29940854 CACCTCCCCAAGAGGGTTGGAGG - Intergenic
904965426 1:34369047-34369069 CTCCCTTCCCTGTGGGGTGGTGG - Intergenic
905249397 1:36638279-36638301 CTCCAGACCAGGAGGGTTGGTGG - Intergenic
905388790 1:37623089-37623111 CTGAGCTCCATGAGGGTTTGGGG + Intronic
906607259 1:47181174-47181196 ATCCCCTCCCTCAGGGCTGGGGG + Intergenic
906846757 1:49200873-49200895 CTCCCCTCCCTGGAGGTTGGGGG + Intronic
907418330 1:54329787-54329809 CTCCCCTCCCTGAGAAATGGGGG + Intronic
909447055 1:75759298-75759320 CTCCCCTCCCTGGAGGTTGTAGG + Intronic
911730670 1:101289235-101289257 CTCCCCCACATGGGGTTTGGTGG - Intergenic
912529709 1:110311550-110311572 TTCCTCTCCAGGAGGGATGGTGG - Intergenic
912665886 1:111579165-111579187 CTCCCCTCCTTGGAGGTTGGAGG + Intronic
912913624 1:113789163-113789185 CACCCCTCCCTGGAGGTTGGGGG - Intronic
916235129 1:162579537-162579559 CTCCCCGCCATGAGTTTTGATGG + Exonic
916658295 1:166897553-166897575 CTCCCCTCCCTAAGGTTGGGAGG - Intergenic
918238810 1:182604158-182604180 CTCCACTCCCTAAGAGTTGGTGG + Intronic
919918512 1:202153922-202153944 CTCCCATCCAGTAGGGGTGGAGG - Intronic
923024621 1:230194817-230194839 CTCCCCTCTATGGTGGATGGGGG - Intronic
924824563 1:247525750-247525772 CTTCCCTCCATGGAGGTTGGGGG + Intronic
1062939825 10:1412944-1412966 CCCCTCTCCATTAGGGTGGGCGG - Intronic
1064903073 10:20315322-20315344 CTCCCCTCCATGCAGGTTGCTGG + Intergenic
1066349299 10:34622519-34622541 ATTCCCTCCTTGATGGTTGGGGG + Intronic
1067214018 10:44285522-44285544 CTCCCATCCCTGGAGGTTGGGGG - Intergenic
1071587740 10:86841780-86841802 CTCCCCTCCCTAAATGTTGGGGG - Intronic
1072489322 10:95888162-95888184 CTCCCCTCCCCAAAGGTTGGGGG - Intronic
1073285333 10:102384056-102384078 CTTCCCTCCCTGGAGGTTGGGGG - Intergenic
1073875970 10:107921312-107921334 CTCTCCTCCTTGAGTGCTGGCGG - Intergenic
1076429495 10:130391644-130391666 CTCCCCTCCATGAGCCCTGCAGG - Intergenic
1077614732 11:3666675-3666697 CTTCCATCCATGGGGCTTGGAGG - Intronic
1078710860 11:13789618-13789640 CTCCACTCCATGGGGTATGGGGG + Intergenic
1079244178 11:18741092-18741114 CTCTCCTCCATCACCGTTGGAGG + Intronic
1079361223 11:19771959-19771981 CTCCCCTCCACCAGCCTTGGAGG - Intronic
1080674336 11:34410972-34410994 GTCCCCTCCCTGGAGGTTGGTGG - Intergenic
1083715319 11:64572004-64572026 GTCCCCTCGATGAGGGTTGTTGG + Exonic
1083782357 11:64925038-64925060 CCCCACCCCATGAGGTTTGGGGG + Intronic
1084320833 11:68372629-68372651 CCCCGCTCCATGGGGTTTGGAGG + Intronic
1084417424 11:69041135-69041157 CTCTCCTCCCTGGAGGTTGGGGG - Intergenic
1085045291 11:73349165-73349187 ATCCCCTAGATGAGAGTTGGAGG + Intronic
1089358178 11:117869429-117869451 CTTCCATGAATGAGGGTTGGAGG - Intronic
1090231802 11:125112188-125112210 GTTCCCTCCAGGAGGGTTGTTGG - Intergenic
1090489611 11:127147062-127147084 CTCCCCCTCCTGATGGTTGGTGG - Intergenic
1091099184 11:132854432-132854454 CTCCCCTCCCTCCAGGTTGGAGG + Intronic
1091468927 12:709820-709842 CTCCCCTCCCTGGAGGTTGGAGG + Intergenic
1091890627 12:4051402-4051424 CTTCCCAGCATGAGGGTGGGAGG - Intergenic
1092698967 12:11205600-11205622 CTCCCCTCCCTGGAGGTTGGGGG + Intergenic
1092955966 12:13550288-13550310 CTCCCCTCCTTGGGGAATGGTGG - Exonic
1095519217 12:43041758-43041780 CTTCCATCCTTGAAGGTTGGGGG + Intergenic
1095634725 12:44419789-44419811 CTCCCCTCCATGAGGGTAATTGG - Intergenic
1096049262 12:48592802-48592824 CTCCCCTCCCTGGAGGTTGGGGG - Intergenic
1096142599 12:49254738-49254760 CTCCCCTCCCTGGAGGATGGGGG + Intronic
1097261061 12:57720547-57720569 CTCCACTCCAGGAGGGCTGGGGG - Intronic
1097990244 12:65825559-65825581 CTCCCCGCCCGGAGGGTTGCTGG - Intronic
1102570265 12:113823135-113823157 CTCACCACCATGTGGGCTGGGGG - Intronic
1103379347 12:120481732-120481754 CTCCCCTCCCTGGAGGTTGGGGG + Intronic
1105940755 13:25146020-25146042 CTCCCCTCCCTGGAGATTGGGGG - Intergenic
1105992082 13:25632321-25632343 CTCCCCTCCCTGGAGGTTGAGGG + Intronic
1107697366 13:43013323-43013345 CTCCCCTCCCTGAAGGTTAGGGG - Intergenic
1111706933 13:91761866-91761888 CTCCCCTCCCTGGAGGTTGGTGG + Intronic
1112238053 13:97653796-97653818 CAGCCCTCCATCTGGGTTGGCGG + Intergenic
1112289242 13:98130430-98130452 CCCCCGTCCATGAGCGTTGACGG - Intergenic
1113952606 13:114080260-114080282 CTCCCGGCCAGGAGGATTGGGGG - Intronic
1114643168 14:24238224-24238246 CCCCCCTCCATGATGGTGGCAGG + Exonic
1114663513 14:24366065-24366087 TTCCCCTTCATGGGTGTTGGGGG - Intronic
1115429562 14:33300760-33300782 CTCCCCTCCATGGGGGATCCTGG - Intronic
1116929280 14:50673736-50673758 CTCCCGTCCCAGAAGGTTGGTGG - Intergenic
1117105787 14:52395783-52395805 CTCCCATCCTTGGGGGTAGGTGG - Intergenic
1119102358 14:71891604-71891626 CTCCTCCCCTTGAGGGTGGGTGG - Intergenic
1121242152 14:92438847-92438869 CTCTCCTCCCTGGAGGTTGGGGG + Intronic
1121341035 14:93105254-93105276 GTCCCCTCCAGGAGGTTTGCTGG - Intronic
1121459570 14:94064467-94064489 CTTCCCTCCCTGGAGGTTGGTGG - Intronic
1122272026 14:100572571-100572593 CTCCCCTCCAGGAGGGGTAAGGG - Intronic
1123646068 15:22438176-22438198 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1124299956 15:28533147-28533169 CTCCCCTCTCTTAGGGTGGGTGG - Intergenic
1125394028 15:39227283-39227305 CTCCCCTTCATGGAGGATGGTGG + Intergenic
1126385998 15:48094038-48094060 TTGCCCTCCATGAGGGTGAGTGG + Intergenic
1128776434 15:70323761-70323783 TTTCCCTCCCTGGGGGTTGGTGG - Intergenic
1129116867 15:73369336-73369358 CCCCTCTCCAGGAGGGTTGCGGG - Intergenic
1131426057 15:92346354-92346376 CTCCCCTCCCTGGAGGTTGAGGG - Intergenic
1132577620 16:671268-671290 CTCCCCTCCATGAGTGACGCTGG + Intronic
1132847597 16:2007589-2007611 CTCCCCTCCGTGGGAGGTGGGGG - Intronic
1134679897 16:16117337-16117359 CTCACTATCATGAGGGTTGGGGG + Intronic
1135138279 16:19900839-19900861 CTTCTCTCCAGTAGGGTTGGTGG + Intergenic
1135838994 16:25856344-25856366 TTCCCCTCCCTGAAGGTTGGAGG - Intronic
1136135648 16:28255448-28255470 CACCCCTCCTAGAGGGATGGTGG - Intergenic
1136172714 16:28498217-28498239 CTCCTCCTCAGGAGGGTTGGGGG - Exonic
1136280820 16:29210164-29210186 CTCCACTCCCAGAGGGCTGGGGG + Intergenic
1136334914 16:29605092-29605114 CTGCCCTCCAGGAGCGTGGGAGG - Intergenic
1136929815 16:34409011-34409033 CTCCCTACCCTGAGGGTTTGGGG + Intergenic
1136974759 16:35002794-35002816 CTCCCTACCCTGAGGGTTTGGGG - Intergenic
1137569061 16:49552861-49552883 ATCCCCTCCTGGAGGGGTGGGGG - Intronic
1139637639 16:68267812-68267834 CTCCCCTCCCCGGAGGTTGGGGG - Intronic
1141651841 16:85397023-85397045 CTCCCCTCCAGCTGGGTGGGTGG + Intergenic
1142085176 16:88176086-88176108 CTCCACTCCCAGAGGGCTGGGGG + Intergenic
1143853163 17:9828052-9828074 CTGCCCTACATGGGGATTGGAGG - Intronic
1144263651 17:13547405-13547427 CTCCCCTCCATGGAGGTTGTAGG - Intronic
1144625240 17:16841045-16841067 CTCCTGTCCATGAGGGCTAGGGG - Intergenic
1144881189 17:18431676-18431698 CTCCTGTCCATGAGGGCTAGGGG + Intergenic
1145112301 17:20174606-20174628 CTCCCCCCCATCAGTCTTGGAGG + Intronic
1145112306 17:20174610-20174632 CTCCCCTCCAAGACTGATGGGGG - Intronic
1145151043 17:20512710-20512732 CTCCTGTCCATGAGGGCTAGGGG - Intergenic
1145889741 17:28406104-28406126 CTCCCCTCCATGTGCGTGCGCGG + Exonic
1146059134 17:29595429-29595451 CTCCCTTGCCTGAGGGTGGGTGG + Intronic
1146417396 17:32648570-32648592 CTCCCCTCCGTGAAGGTTAAGGG - Intronic
1146458269 17:33024003-33024025 CTCCCCTCCAGGTCTGTTGGCGG - Exonic
1147192595 17:38746807-38746829 CTCCCCTGGTTGGGGGTTGGGGG - Intronic
1147579395 17:41619744-41619766 CTCCTGTCCATGAGGGCTAGGGG - Intronic
1148028026 17:44601689-44601711 CTCCCCTGCTTGTGGGTGGGAGG - Intergenic
1148273335 17:46281227-46281249 CTGCACTCTATGAGGGGTGGGGG - Intronic
1148479228 17:47949333-47949355 GTCCCCTCCTTGGGGGTTGAGGG - Intergenic
1148900625 17:50873369-50873391 CACTCCTCCATGAGAGGTGGTGG - Intergenic
1150409721 17:64933334-64933356 CTGCACTCTATGAGGGGTGGGGG + Intergenic
1150475500 17:65471565-65471587 CTTCCCTCCTTCAGCGTTGGTGG + Intergenic
1151307500 17:73272709-73272731 CTCCTCCCCATGGGGGTAGGGGG - Intergenic
1151841981 17:76625523-76625545 CTCACCTACATCACGGTTGGAGG + Exonic
1151975259 17:77480724-77480746 CTCCCCTCCCGGAGGACTGGCGG + Intronic
1153807010 18:8717648-8717670 CTCCCCTCCCCCAGGGATGGAGG + Intronic
1154153707 18:11927622-11927644 CTCCCTTCCCTGGAGGTTGGGGG + Intergenic
1154217789 18:12428260-12428282 CTCCCCTCCAGCAGAGTTGATGG + Intronic
1154319127 18:13330803-13330825 CTCCCCTCCCTGGAGGGTGGGGG - Intronic
1157688349 18:49661054-49661076 CTCCCCTCCCTGGAGGTCGGGGG - Intergenic
1158505303 18:58042379-58042401 CTCCCATCCATGAGGGTCACAGG + Intergenic
1159885945 18:73906996-73907018 CTCCCTGAAATGAGGGTTGGTGG - Intergenic
1161435235 19:4258955-4258977 GTCCCATCCATGAGGGTGGGAGG + Intronic
1161912663 19:7206163-7206185 CTCAACTCCCTGAGGGGTGGGGG - Intronic
1162031991 19:7921525-7921547 CTCACCTCTATGGGGGCTGGGGG - Exonic
1162052157 19:8041125-8041147 ATCCCTTCCATGAGGTTTGATGG + Intronic
1162127287 19:8506349-8506371 CTCCTGTGCATGGGGGTTGGGGG + Intergenic
1162155646 19:8676648-8676670 GTCCCCTCCATGGGTGATGGTGG + Intergenic
1163417010 19:17192955-17192977 AGCCCCTCCATGAGGCCTGGAGG - Exonic
1164582237 19:29441838-29441860 CTTCTCTGCATGAGGGTTGGGGG - Intergenic
1164609554 19:29622852-29622874 GTTCCCACCATGAGGGTTGCAGG - Intergenic
1165746901 19:38234901-38234923 CTCCCTGCCATGAAGGTTGAGGG - Intergenic
1166634530 19:44438676-44438698 CTCCCCTCACTGGAGGTTGGGGG - Intronic
1167014355 19:46830647-46830669 CTCGCCTCCCTGAGGGTCCGAGG + Intergenic
1167361249 19:49031730-49031752 CTCCCCTCCCTGAGGGCCCGAGG + Intronic
1168406896 19:56115119-56115141 CTGCCCTCCCTGAGGGTGGTGGG + Intronic
1168634417 19:57984474-57984496 GTCCCCTCCATTAGAGTGGGTGG + Intronic
1168712648 19:58510832-58510854 CTCCCCTACACCAGGGGTGGGGG - Exonic
925413016 2:3650776-3650798 CTCCCCTCCATGAAGCCTGGTGG - Intergenic
926759861 2:16268809-16268831 CTCCCTTCCCTGGTGGTTGGGGG - Intergenic
927197545 2:20558783-20558805 CTCCCCTCCCACAGGCTTGGAGG - Intergenic
927694579 2:25231195-25231217 CGCCACTCCAGGAGGGCTGGGGG - Exonic
928588218 2:32784803-32784825 CTCCCATCCACAGGGGTTGGGGG - Intronic
929836899 2:45410695-45410717 CTCCCCTCCCTGGAGGTTGGGGG - Intronic
930009267 2:46923273-46923295 CTCTCCTCCCTGGAGGTTGGAGG + Intronic
932053121 2:68418757-68418779 TTCCCCTCCATGGGGGTGGTGGG + Intergenic
932551573 2:72775222-72775244 CTCCCCTCCCTGGAGGTTGGGGG + Intronic
934027187 2:88010790-88010812 GTCCCCTCCCTGGAGGTTGGGGG + Intergenic
936170444 2:110167352-110167374 CTCCCCTCTTTGAAGGTTGGAGG - Intronic
939593592 2:144097548-144097570 CTCCCATCACTGAGGGCTGGAGG + Intronic
939719815 2:145634741-145634763 CTCCCCTCCCTGGAGGTTAGAGG + Intergenic
940962139 2:159797930-159797952 CTCCCCTCCCCGAGGGCAGGCGG + Intronic
941960028 2:171244387-171244409 CTCCCCTCCCGGGAGGTTGGAGG - Intergenic
943024132 2:182608156-182608178 CTCTTCTCCAAGAGGGGTGGGGG + Intergenic
946442741 2:219710597-219710619 CTCCCATGCATGAAGCTTGGAGG + Intergenic
948065793 2:235078205-235078227 CTCCCCTCCCTGGAGGTTGCAGG + Intergenic
948836479 2:240628542-240628564 CCCCAGTCCATGAGGGATGGAGG - Intronic
1170604950 20:17868981-17869003 CTCTCCCCCATCAGGGGTGGCGG - Intergenic
1170907075 20:20525901-20525923 ATGCCCTCCGTGAGGGGTGGAGG - Intronic
1170959271 20:21010616-21010638 CTCCCTTCCATGGAGGTTGAAGG + Intergenic
1171036364 20:21715296-21715318 CCCCCCTCCATTAGGGCTGGTGG - Exonic
1172092787 20:32445873-32445895 CTCCCCCCAAGGAGGGATGGGGG - Exonic
1172270527 20:33653330-33653352 CTTCCTTCCAAGAGGCTTGGGGG + Intergenic
1174893995 20:54429367-54429389 CTCCCAACCATGAGACTTGGAGG - Intergenic
1175308567 20:57995069-57995091 CTCCCCTCCACAAAAGTTGGGGG - Intergenic
1175998342 20:62821238-62821260 CTCCTCTCCATGGGAGTTTGGGG + Intronic
1179571370 21:42280704-42280726 ATCCCCTCCGTGAGGGTGGAGGG + Intronic
1181711652 22:24695330-24695352 CTACCCTCCACCAGGGTTGTGGG - Intergenic
1183393551 22:37559689-37559711 CTGCCCTCCATGGAGGTGGGCGG + Intergenic
1184835293 22:47017417-47017439 CTGCCCTCCCTGAGTGTTGGGGG + Intronic
1184976592 22:48066686-48066708 GTCCCTTCCATGAGTGTTTGAGG + Intergenic
950703765 3:14767472-14767494 GTCCCCTCCCTGTGGGATGGGGG + Intronic
951513175 3:23527626-23527648 CTCCTCTCCCTGAGGGTTATAGG - Intronic
951741750 3:25932171-25932193 CTCCCCTTCAGGAGGCATGGGGG - Intergenic
952218913 3:31304669-31304691 CTCCCCTCCCTGGAGGTTAGGGG + Intergenic
954145614 3:48632916-48632938 CTGCCCTCCATGATGGATGTGGG + Intronic
956056189 3:65301241-65301263 CTCCCCTCCCTGAAGGTTAGGGG + Intergenic
956458044 3:69443148-69443170 CTCCCCTCCCTGGGGGTCAGGGG - Intronic
961348588 3:126282659-126282681 CTCCCCTCTTTGGAGGTTGGGGG - Intergenic
962326757 3:134440818-134440840 TTCCCCTCCCTGTGGGTTGGGGG + Intergenic
966851467 3:184167641-184167663 CTCCCCTGAATCAGGGTTGGAGG + Exonic
967007415 3:185397772-185397794 CTGCCTGCCATGAGGGTTGTGGG + Intronic
967661205 3:192112709-192112731 CTCCCCTCCCTAAAGGTTAGAGG - Intergenic
968744130 4:2350676-2350698 CTCCCCTCCCCGGAGGTTGGGGG - Intronic
969247335 4:5944268-5944290 AGCCCCTCCATGAAGGCTGGAGG + Intronic
971363278 4:25955951-25955973 CTCCCCTCCCTGGAGGTTGAGGG - Intergenic
972647699 4:40984633-40984655 CTCCACTCCTTGAGGGTTCCAGG - Intronic
972840365 4:42923144-42923166 CACCCCTCCATAAGGGAGGGAGG + Intronic
973586930 4:52402383-52402405 CTCCCTTCCCTGGAGGTTGGGGG + Intergenic
973808057 4:54544608-54544630 GTGCCCTCCATGAGGGTGGGTGG - Intergenic
974446624 4:61992603-61992625 CATCCCTCCATGAGGGCTGCTGG - Intronic
975608831 4:76183712-76183734 CTCCCCTCCTGGGAGGTTGGGGG + Intronic
979205481 4:118033395-118033417 CGCCCCTCCCGGCGGGTTGGCGG - Intergenic
980105269 4:128582584-128582606 GTCCCTTCCATCAGGGTTGGTGG + Intergenic
982575930 4:157110059-157110081 CTCCCCTCCCTGAAGGTTGCGGG + Intronic
983936860 4:173508458-173508480 AACCCCTCCATGTGTGTTGGCGG - Intergenic
984750078 4:183263817-183263839 CTGCCCTGCATGTGGGGTGGTGG + Intronic
985139302 4:186822281-186822303 CTCCCCTCCCTGGAGATTGGGGG + Intergenic
985799757 5:1997232-1997254 CTCCCACCCATGAGGGCAGGTGG - Intergenic
985902428 5:2806804-2806826 CTCCCCTCCATCAGGTGAGGAGG - Intergenic
990786415 5:59425498-59425520 GTCCCCTGCATGAGAGGTGGAGG + Intronic
991065961 5:62425230-62425252 TTCCCCCCAAGGAGGGTTGGAGG - Intronic
997353414 5:133247054-133247076 CTCCCCTACCTGAGGGAAGGAGG - Intronic
997651024 5:135520705-135520727 CTTCCCTCCCTGGAGGTTGGTGG + Intergenic
998128676 5:139640287-139640309 GTCCCCTCCAGGAAGGTGGGAGG + Intergenic
1000356818 5:160404804-160404826 CTTACCTCCATGAGGGTTTGAGG + Exonic
1001012219 5:168108882-168108904 GTCCCCTCCCTGAGGGTAGCTGG + Intronic
1004590891 6:17050572-17050594 CTCCCCTCCCTCTAGGTTGGGGG - Intergenic
1004906607 6:20242413-20242435 CTCCCCTCCCTGGTGGGTGGGGG + Intergenic
1005643631 6:27820234-27820256 CTCCCCTACATGAGGCTTCCAGG + Intergenic
1007420611 6:41716977-41716999 CCACCCTCCATGAAGGGTGGGGG + Intronic
1009992686 6:70863486-70863508 CTCCCTCCCTTTAGGGTTGGTGG - Intronic
1011536477 6:88381430-88381452 CTCCCCATCACCAGGGTTGGGGG - Intergenic
1013346365 6:109264296-109264318 ATCCCCTCCTTGGGGGTTTGTGG - Intergenic
1013652089 6:112205806-112205828 CTCTCCTCCCTGGAGGTTGGGGG - Intronic
1016118993 6:140324610-140324632 CTCCCTTCCCTGGAGGTTGGAGG + Intergenic
1016343565 6:143086992-143087014 CTCCCAACCCAGAGGGTTGGGGG + Intronic
1016779169 6:147939343-147939365 CTCCCCTCCCTGGAGGTTGAGGG + Intergenic
1018103852 6:160464981-160465003 CTTCCCTCCCTGGAGGTTGGAGG - Intergenic
1018112141 6:160546197-160546219 CTTCCCTCCCTGGAGGTTGGAGG - Intronic
1018743432 6:166747146-166747168 CTCCTCTTCCTGGGGGTTGGGGG + Intronic
1023299869 7:38758749-38758771 CTCCCCTCCTTGGAGGTTGTGGG - Intronic
1023439684 7:40172789-40172811 CTCCCAACCAGAAGGGTTGGGGG + Intronic
1024678220 7:51657212-51657234 CTCCCCTCCCTGAAGGTAGAGGG - Intergenic
1025197721 7:56945460-56945482 CTTCCCGCCATGAGGGTGGTTGG - Intergenic
1026878806 7:73895081-73895103 CCCCCCTCCCTGGGGGTTGTGGG - Intergenic
1026957000 7:74383295-74383317 TTCCAATCAATGAGGGTTGGGGG - Intronic
1029036698 7:97529704-97529726 CTCCCCTCCCTGGAGGTTAGGGG + Intergenic
1031368019 7:120927159-120927181 CTTCCCTCCCAGAGGGCTGGAGG - Intergenic
1033147530 7:138884030-138884052 CTTCCCTCCCTGAAGGTTGGGGG - Intronic
1034232152 7:149538941-149538963 CTCCCCTCCCTGGAGGTAGGGGG + Intergenic
1038915572 8:32017913-32017935 CTCCCATCCCTGGAGGTTGGGGG + Intronic
1040548991 8:48423840-48423862 ATCACCTCCATAAGGGTTGAAGG + Intergenic
1041801928 8:61809683-61809705 CTCCCCTCCATGAGGCTGTGAGG - Intergenic
1043091292 8:75907732-75907754 CTTCCCTCCCTGAAGGTTGAGGG - Intergenic
1048936627 8:139362835-139362857 CTCCCCTGCATCTGGGTTGGGGG + Intergenic
1048985869 8:139734552-139734574 CTGCCCTCCAGGAAGGCTGGAGG + Intronic
1049047063 8:140161141-140161163 CTCCCCTGCTGAAGGGTTGGGGG - Intronic
1051109944 9:13624642-13624664 CTCCCCTCCCTGGAGATTGGGGG - Intergenic
1051594541 9:18811232-18811254 CTCCCCTCCATGAGGGTTGGGGG - Intronic
1053004777 9:34597177-34597199 TTCTCCTCCATGAGGAATGGTGG - Intergenic
1058182586 9:101816204-101816226 CTCCCCACCAGGAGGCATGGGGG - Intergenic
1059974731 9:119703342-119703364 CTGCCCTCCTTGAGGATTGTAGG + Intergenic
1060129555 9:121081868-121081890 CTCCCCTCCTTAAAGGTTGTGGG + Intronic
1061078329 9:128355211-128355233 AGCCCCTTCCTGAGGGTTGGGGG + Intronic
1062101288 9:134730056-134730078 CCCCCATCCATGGGGCTTGGGGG - Intronic
1062440787 9:136568428-136568450 CTCCCCTCCAGCTGGGGTGGGGG - Intergenic
1185952397 X:4451569-4451591 CTCCCTTGGCTGAGGGTTGGGGG - Intergenic
1186653138 X:11583181-11583203 CTGCTCTCCAGGATGGTTGGTGG + Intronic
1187996306 X:24930691-24930713 ATCCCCTGCATGAGGGGCGGTGG + Intronic
1189509940 X:41652585-41652607 CTCCCCTCCCTGGAGGTTGGGGG - Intronic
1190081454 X:47359762-47359784 CTCCCCTCCCAGGAGGTTGGGGG + Intergenic
1190083103 X:47372239-47372261 CTCCCCTCCCAGGTGGTTGGAGG - Intronic
1190595945 X:52052767-52052789 CTCCCCTCAATGCTGGGTGGAGG - Exonic
1190612879 X:52201306-52201328 CTCCCCTCAATGCTGGGTGGAGG + Exonic
1190653728 X:52592826-52592848 CTCCCTTCCCTGATGTTTGGGGG - Intergenic
1190684760 X:52861897-52861919 CTCCCTTCCCTGAAGGTTTGGGG + Intergenic
1190706387 X:53031610-53031632 CTGCCCTCCCCGAGCGTTGGGGG - Intergenic
1190912534 X:54786340-54786362 CTCCCATCCATGCTGCTTGGAGG + Intronic
1190955621 X:55190041-55190063 CTCCCTTCCCTGAGGGTTGGGGG + Intronic
1191871035 X:65745374-65745396 CTCCCCTCCCTGGAGGTTAGAGG - Intergenic
1193530151 X:82646385-82646407 CTTCCCTCCCTGCAGGTTGGGGG - Intergenic
1194198677 X:90928721-90928743 CTCCCATCCCTGGAGGTTGGTGG - Intergenic
1197243727 X:124146994-124147016 CTCCCTTCCAGGAGGTTTGTTGG - Intronic
1199737035 X:150694019-150694041 CTCCCTCCCAAGAGGATTGGTGG - Intronic
1200119246 X:153782699-153782721 CTCCCCTAGCTGAGGGTGGGTGG + Intronic
1200544671 Y:4505165-4505187 CTCCCATCCCTGGAGGTTGGTGG - Intergenic