ID: 1051598588

View in Genome Browser
Species Human (GRCh38)
Location 9:18849632-18849654
Sequence GAGTGGGAAAGGAAGACGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051598569_1051598588 25 Left 1051598569 9:18849584-18849606 CCAAGGAAGGACAGGGATGCCGG 0: 1
1: 0
2: 1
3: 32
4: 235
Right 1051598588 9:18849632-18849654 GAGTGGGAAAGGAAGACGGAGGG No data
1051598577_1051598588 6 Left 1051598577 9:18849603-18849625 CCGGGAAGGGGAGGACTGGCCCC 0: 1
1: 0
2: 0
3: 22
4: 296
Right 1051598588 9:18849632-18849654 GAGTGGGAAAGGAAGACGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051598588 Original CRISPR GAGTGGGAAAGGAAGACGGA GGG Intronic
No off target data available for this crispr