ID: 1051599118

View in Genome Browser
Species Human (GRCh38)
Location 9:18854431-18854453
Sequence AAGTTTCTTGTGTATCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051599118_1051599125 21 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT No data
Right 1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG No data
1051599118_1051599124 20 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT No data
Right 1051599124 9:18854474-18854496 GAAGAGGAACCAGGTAGTTGAGG No data
1051599118_1051599122 11 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT No data
Right 1051599122 9:18854465-18854487 TGCCTGTGAGAAGAGGAACCAGG No data
1051599118_1051599126 27 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT No data
Right 1051599126 9:18854481-18854503 AACCAGGTAGTTGAGGGAGATGG No data
1051599118_1051599121 4 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT No data
Right 1051599121 9:18854458-18854480 TACTGGTTGCCTGTGAGAAGAGG No data
1051599118_1051599127 28 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT No data
Right 1051599127 9:18854482-18854504 ACCAGGTAGTTGAGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051599118 Original CRISPR AAGTTTCTTGTGTATCTGTA TGG (reversed) Intronic