ID: 1051599118

View in Genome Browser
Species Human (GRCh38)
Location 9:18854431-18854453
Sequence AAGTTTCTTGTGTATCTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 1, 2: 3, 3: 24, 4: 301}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051599118_1051599121 4 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT 0: 1
1: 1
2: 3
3: 24
4: 301
Right 1051599121 9:18854458-18854480 TACTGGTTGCCTGTGAGAAGAGG No data
1051599118_1051599127 28 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT 0: 1
1: 1
2: 3
3: 24
4: 301
Right 1051599127 9:18854482-18854504 ACCAGGTAGTTGAGGGAGATGGG No data
1051599118_1051599126 27 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT 0: 1
1: 1
2: 3
3: 24
4: 301
Right 1051599126 9:18854481-18854503 AACCAGGTAGTTGAGGGAGATGG No data
1051599118_1051599125 21 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT 0: 1
1: 1
2: 3
3: 24
4: 301
Right 1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG No data
1051599118_1051599124 20 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT 0: 1
1: 1
2: 3
3: 24
4: 301
Right 1051599124 9:18854474-18854496 GAAGAGGAACCAGGTAGTTGAGG No data
1051599118_1051599122 11 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT 0: 1
1: 1
2: 3
3: 24
4: 301
Right 1051599122 9:18854465-18854487 TGCCTGTGAGAAGAGGAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051599118 Original CRISPR AAGTTTCTTGTGTATCTGTA TGG (reversed) Intronic
906757484 1:48332220-48332242 AAGTTTCTTATTGATATGTATGG - Intronic
906836583 1:49089429-49089451 AGGTTTTTTGTATTTCTGTAAGG - Intronic
908230604 1:62101064-62101086 AAGTTTTTTGTGTATTTTTGTGG - Intronic
908559776 1:65294008-65294030 AAGTTTCTTGTTAATTTGCAGGG + Intronic
908699937 1:66888001-66888023 AAATATCTATTGTATCTGTATGG + Intronic
909599240 1:77443808-77443830 AACTTTATTGTATATGTGTAAGG + Intronic
909628340 1:77744444-77744466 AAATTGCTTGTGGATCTGTAGGG - Intronic
909680228 1:78283528-78283550 AATTTTATTGTGTATATTTAAGG + Intergenic
909716287 1:78710938-78710960 AAGTTTATTGTGTATATTTGAGG - Intergenic
910103220 1:83600401-83600423 AAGTTTTCTGTATATCTGTTAGG - Intergenic
911551927 1:99292980-99293002 CAGTTTCTTTTCTATCTTTAGGG + Intronic
911899316 1:103482054-103482076 CAGTTCTTTCTGTATCTGTAAGG + Intergenic
912280885 1:108312227-108312249 ATGTTGTTTGTGTCTCTGTAAGG - Intergenic
913032959 1:114930574-114930596 AAATTTCTTATGTATCTTTTAGG + Intronic
913552681 1:119931320-119931342 AAGTCTCTTTTGTGTCTGTTAGG - Intronic
917835099 1:178935348-178935370 GAGTTTCTTGTCTGTCTCTAAGG + Intergenic
918761288 1:188413077-188413099 CAGTTTTTTGTGTATTTGTGTGG + Intergenic
919437547 1:197580718-197580740 CAGTTTCCTGGGGATCTGTAAGG - Intronic
920083646 1:203397327-203397349 AAATTTATTGTGTATATTTAAGG + Intergenic
922018270 1:221675232-221675254 AAGTTTCCTGTGTCCCTGGAGGG - Intergenic
922070551 1:222188415-222188437 AAATTTCCTGTGTATCTTTACGG - Intergenic
924044744 1:240016300-240016322 ATTTTTCTTGTGTATGTCTAAGG + Intronic
924359684 1:243224728-243224750 AATTTTATTGTGTATATTTAAGG - Intronic
1064321890 10:14312948-14312970 TAGTTTCTTGTGTATCCTTTTGG - Intronic
1068033803 10:51735525-51735547 ATATTTCTTGTGTTTCTTTAAGG - Intronic
1068364058 10:56021142-56021164 AATTTTATTGTGTATATTTAAGG - Intergenic
1069561486 10:69433728-69433750 AATTTTATTGTGTATATTTAAGG + Intergenic
1070002371 10:72389365-72389387 CAGTTTCTTTTGTCTCTGGAGGG - Intronic
1071142475 10:82526252-82526274 AATTTTATTGTGTATATTTAAGG - Intronic
1071776323 10:88792255-88792277 AATTTTCTTCTATATCTTTAAGG + Intergenic
1073197719 10:101707047-101707069 TAGGTTTTTGTGTATCTTTATGG - Intergenic
1077819032 11:5717683-5717705 AATTTTATTGTGTATATTTAAGG + Intronic
1077876244 11:6309759-6309781 AAGTTTCTTATGTTTATGAATGG - Intergenic
1078694471 11:13617116-13617138 AGGTTTTATGTGTTTCTGTAGGG + Intergenic
1079393439 11:20041826-20041848 AAGTTTCTTTTCTTTCTTTAGGG + Intronic
1080581371 11:33646660-33646682 AAGTATTTTGTGTGTGTGTAAGG - Intronic
1080784630 11:35463552-35463574 AAGTTTCCTGTTTCTTTGTATGG - Intronic
1081338272 11:41895249-41895271 GAGGTTCTTGAGTATCTTTATGG - Intergenic
1081373040 11:42327301-42327323 CAGTCCCTTGTGTCTCTGTAAGG - Intergenic
1085102383 11:73812227-73812249 CAATTTCTTGTGTATCTTTCAGG + Intronic
1085819008 11:79771993-79772015 AACTTACTTGTGTATATGTCTGG - Intergenic
1086972717 11:93100881-93100903 AAATTGCTTGTGTGTGTGTATGG + Intergenic
1087855066 11:103082044-103082066 ATGTTTCTAGTGTTTCTGCAGGG - Intronic
1088120801 11:106366799-106366821 AAATTCTTTGTGTATCTATAAGG + Intergenic
1088924561 11:114287453-114287475 AAGATAATTGGGTATCTGTAGGG - Intronic
1089760866 11:120722211-120722233 AAATTTCTTGTGTTTATATATGG + Intronic
1091190114 11:133686052-133686074 AATTTTGTTGTATATGTGTAAGG - Intergenic
1092047874 12:5445211-5445233 AAGTTTCTTGGGCATATGAAGGG + Intronic
1092321455 12:7480801-7480823 AATTTTGTTGTGTATATTTAAGG - Intronic
1093355063 12:18156784-18156806 AAGTTGAATGTGTATCTGAAAGG + Intronic
1093482666 12:19620939-19620961 AATTTTATTGTGTATATTTAAGG - Intronic
1093598990 12:20999010-20999032 AAGATTCATGTGTATCTGTTAGG + Intergenic
1094381278 12:29845920-29845942 ATGTTCATTTTGTATCTGTATGG - Intergenic
1095411834 12:41933009-41933031 AAGCTTATTGTTTATTTGTATGG + Intergenic
1095880214 12:47127783-47127805 ATGTTCCATGTGTATCTGAAAGG + Intronic
1097093126 12:56523456-56523478 AATTTTATTGTGTATATTTAAGG - Intronic
1098277574 12:68828757-68828779 AATTTTCTTCTGGATATGTAAGG - Exonic
1098670679 12:73226078-73226100 TTGTTTCTGGTGTATCTGTAAGG - Intergenic
1098978988 12:76934540-76934562 TAGTTTGTTCTATATCTGTAGGG + Intergenic
1099251442 12:80259994-80260016 AAATTTATTGTTTATCTGTCTGG + Intronic
1099784393 12:87241872-87241894 AGGTTTATTATCTATCTGTATGG - Intergenic
1100629776 12:96376012-96376034 AAGTTTCTTGTGGTTCTAAATGG + Intronic
1100700193 12:97139153-97139175 AAGTTTCCAGTCTATCTGTCTGG - Intergenic
1101159636 12:101960311-101960333 TATTGTCTTGTGTATGTGTATGG - Intronic
1103078015 12:118000430-118000452 AAGTTTCTACTGTAACTCTAGGG - Intergenic
1103205871 12:119128489-119128511 AAGTTTCAGGCGTCTCTGTAAGG - Intronic
1103219445 12:119231555-119231577 TGGTTTCTTGTGTCCCTGTATGG + Intergenic
1103751208 12:123164011-123164033 AAGTCTCTTTTGTCTCTGTTGGG + Exonic
1104139495 12:125973794-125973816 AAGTTTCTGGTATACCTGTAAGG - Intergenic
1104166068 12:126230749-126230771 CAGTTTGTTGTGTACCTGGAAGG + Intergenic
1106158231 13:27177188-27177210 CAGTTTCTTGTGTATATGACAGG - Intergenic
1106811669 13:33364475-33364497 AAGTTTGTTGTGTGTCTGAATGG + Intergenic
1106966356 13:35074692-35074714 AATTTTATTGTGTATGTTTAAGG + Intronic
1107246181 13:38297799-38297821 AAGTTTCTTGTGCACTTGAATGG - Intergenic
1107459726 13:40590202-40590224 AGGTTTCTTGTTTATCTGAATGG - Intronic
1107665645 13:42687764-42687786 AATTTTATTGTGTATATTTAAGG - Intergenic
1109663427 13:65496539-65496561 AAGTATATTGTACATCTGTATGG + Intergenic
1110781867 13:79475531-79475553 AAGTTCCTTTTGTATCTGGCTGG - Intergenic
1111886006 13:94021967-94021989 AATTTTACTGTGTATCTTTAAGG + Intronic
1112263946 13:97905174-97905196 AAGTTCCATTTGTATCTCTAGGG - Intergenic
1115669637 14:35595393-35595415 AAGTTTATTGTGTATATTTAGGG - Intronic
1116228479 14:42183975-42183997 AAGTTTGTTGTAAATCTATAAGG - Intergenic
1118626695 14:67665785-67665807 AAGTATCTTGTGTATATTAAGGG - Intronic
1120157472 14:81109465-81109487 GATTATCTTGTGTATCTCTACGG - Intronic
1121148886 14:91611847-91611869 AATTTTGTTGTGTATATTTAAGG - Intronic
1121871180 14:97409001-97409023 AAGTATTCTGTGTATCTGAAAGG + Intergenic
1121890371 14:97584578-97584600 CAGTCTCTTGTTTATCTGTCAGG + Intergenic
1124952153 15:34333576-34333598 CAGTTTCTTTTGTATCTTTAAGG + Intronic
1125239837 15:37561426-37561448 AAGGTTTTTGTATTTCTGTAGGG - Intergenic
1125445597 15:39751946-39751968 AATTTTATTGTGTATATTTAAGG - Intronic
1125995601 15:44156938-44156960 TAGTTTCTTATGTATCTAGAAGG - Intronic
1127338253 15:58012540-58012562 CAGTGTCTTGTGAATCTGCAAGG + Intronic
1127551579 15:60043936-60043958 ATATTTGTTGTGTATCTGCAAGG - Intronic
1130319525 15:82829098-82829120 AAGTTTTTTGAATATCTGAAGGG + Intronic
1131608162 15:93931797-93931819 AAGTTTTCTATGTATTTGTAGGG - Intergenic
1133710978 16:8400892-8400914 AATTTTATTGTGTATATTTAAGG + Intergenic
1134303371 16:13011204-13011226 AATTTTATTGTGTATATTTAAGG + Intronic
1136252874 16:29017924-29017946 AATTTTTTTGTGTGTGTGTACGG + Intergenic
1137627808 16:49920698-49920720 ACGTTTATTGTGTTTCTGTGTGG - Intergenic
1138401885 16:56752662-56752684 AAGTCTCTTGTATCTCTATATGG - Intronic
1138811724 16:60158682-60158704 AACTTCCTTGGGTCTCTGTAGGG + Intergenic
1139971660 16:70780177-70780199 AATTTTCTTGTTTAGCTGTAAGG - Intronic
1141308396 16:82888677-82888699 AAGTTTCTTCTGTTCCTGAATGG + Intronic
1142543789 17:683668-683690 AATTGTATTGTGTATATGTAAGG - Intronic
1142956109 17:3523853-3523875 AAGTCTTTTGTGTATATATATGG + Intronic
1143425612 17:6834628-6834650 CAGTTTCTTATGTATCTGTCTGG - Intergenic
1144615014 17:16761430-16761452 CAGTTTCCTGTGCTTCTGTAAGG - Intronic
1144897690 17:18554239-18554261 CAGTTTCCTGTGCTTCTGTAAGG + Intergenic
1145134682 17:20391480-20391502 CAGTTTCCTGTGCTTCTGTAAGG - Intergenic
1150585575 17:66514874-66514896 AGGTTTCTGGTTTATCTGGATGG + Intronic
1151484357 17:74389295-74389317 TACATTCTTGTGTAACTGTAGGG + Intergenic
1154134708 18:11765907-11765929 AAGTTTGTTGTTCATCTCTAAGG + Intronic
1155498169 18:26462812-26462834 AAGTTTAGTGTGTTTCTGTTAGG + Intronic
1156753306 18:40488485-40488507 AAGTTTCTTCTCAATGTGTAGGG - Intergenic
1156946188 18:42835359-42835381 AATTTTATTGTGTATATTTAAGG - Intronic
1156967361 18:43110849-43110871 AACTTTATTGTGTATATTTAAGG + Intronic
1157106357 18:44778015-44778037 AAGCTTCTTGTGTGTGTGGATGG + Intronic
1157317554 18:46604985-46605007 AATTTTTTTGTGTATATTTAAGG - Intronic
1164966338 19:32487842-32487864 AAGTTTCTTAAGTTTCTTTAAGG + Intergenic
1165498836 19:36171467-36171489 TTGTTTCTTGTGTATCTTTCTGG + Intergenic
1167837207 19:52083717-52083739 AATTTTATTGTGTATATTTAAGG + Intronic
925031273 2:651618-651640 ATGATTCTTGTGCATCTTTACGG + Intergenic
926704167 2:15825131-15825153 AAGCTCCTTGAGTAACTGTACGG - Intergenic
927160265 2:20251411-20251433 AAGGTTCTTGTGTATATTTGGGG - Exonic
928056101 2:28056384-28056406 AATTTTATTGTGTATATTTAAGG - Intronic
928769095 2:34684528-34684550 AAGTTTCGTATGTTTCTTTAAGG + Intergenic
928791533 2:34961753-34961775 AATTTTATTGTGTATTTTTAAGG + Intergenic
928978431 2:37113630-37113652 CATTTTCTTGTGTATCTGTAAGG - Intronic
929620857 2:43352626-43352648 AATTTTATTGTGTATATTTAAGG + Intronic
931129887 2:59323456-59323478 AAGTTTCTTGTGAACATGTCTGG + Intergenic
931519139 2:63076148-63076170 AATTTTATTGTGTATATTTAAGG + Intergenic
932081643 2:68721040-68721062 AAGTTTCATGTGTAGCTCCAGGG - Intronic
933895132 2:86804173-86804195 AATTTTATTGTGTATATATAAGG - Intronic
935486899 2:103667419-103667441 AAGATTCTTATGAATCTGTGAGG + Intergenic
935511123 2:103975420-103975442 AATTTTATTGTGTATATTTAAGG + Intergenic
937570109 2:123347189-123347211 AAATTTTTGGTGGATCTGTAGGG - Intergenic
940144339 2:150529982-150530004 AAGTTTCTTGAGTGTCTCTAGGG + Intronic
940322475 2:152391466-152391488 ATGTGTCTTGTGTATCTGGCTGG + Intronic
941610258 2:167652911-167652933 AAGTTGTTTGTGTATTTATATGG + Intergenic
942136443 2:172930815-172930837 AAGTTTCTTTTATGTCTGGATGG - Intronic
942604600 2:177677175-177677197 AAGTTTATTGAGTATCTGCTAGG + Intronic
942632533 2:177966817-177966839 TTTTTTCTTGTGTCTCTGTAAGG + Intronic
943380046 2:187133416-187133438 CAGTTGCATGTGTATGTGTATGG + Intergenic
944117623 2:196206415-196206437 AATTGACTTGTCTATCTGTAGGG - Intronic
944530963 2:200667613-200667635 AAATTCCATGTGTTTCTGTAGGG - Intronic
945723319 2:213446136-213446158 CTGTTTCTTATGTATCTGTGTGG - Intronic
948245555 2:236481229-236481251 AAGCATCATGAGTATCTGTAAGG - Intronic
948414885 2:237796000-237796022 GAGTTTCCTGTGTCTGTGTATGG - Intronic
1170117974 20:12881634-12881656 AAGTTTCTAGTGGGTCTATATGG - Intergenic
1171231887 20:23493433-23493455 AAGTTCCTTTTGTGTCTGTATGG - Intronic
1171541630 20:25962318-25962340 AATTTTATTGTGTATATTTAAGG - Intergenic
1171844619 20:30258455-30258477 AATTTTATTGTGTATATTTAAGG - Intergenic
1176783754 21:13230605-13230627 AATTTTGTTGTGAATCTGTCTGG + Intergenic
1177005487 21:15667032-15667054 AAGTTTCATTTGTATTTGTTTGG + Intergenic
1177066697 21:16445933-16445955 AATATTTTTGTGTAGCTGTACGG + Intergenic
1177974644 21:27832077-27832099 ATTTTTCTTCTGTATCTGAAAGG - Intergenic
1178536918 21:33417745-33417767 AAGCTTCTTGTTTAGCTCTAGGG - Intronic
1179610450 21:42546813-42546835 AATTTTATTGTGTATATTTAAGG + Intronic
1180210028 21:46289976-46289998 CAGTTTCGTGTGTGTGTGTAAGG + Intronic
1180945624 22:19691236-19691258 AAGTGTCTTGTGTGTTTGGAGGG - Intergenic
1183256705 22:36767046-36767068 AAGGTTCTTGAGTCTCTTTATGG - Intronic
1183993956 22:41619465-41619487 CAATTTCTTGTGTATCCTTACGG + Intronic
949188543 3:1222893-1222915 TAGTTTCTTGTCTATGAGTAAGG - Intronic
949302313 3:2598354-2598376 AAGTTTCTGGTGTATTTTAAGGG + Intronic
949746488 3:7299586-7299608 AAGTTTCTTGTATATCCTTGTGG + Intronic
951639487 3:24820177-24820199 AAATTTTTTGTCTATCTGTTGGG - Intergenic
952785369 3:37149650-37149672 AAGTTACTTTTGTAACTATAAGG - Intronic
953544262 3:43852058-43852080 GATTTTCTTGTGTACCTTTAAGG + Intergenic
956005486 3:64774388-64774410 AAGATTCTGGTATATCTGCAAGG + Intergenic
956604626 3:71061279-71061301 TAGCTTTATGTGTATCTGTATGG - Intronic
959501548 3:107112082-107112104 AAATTTCTGTTGTATCTGGATGG - Intergenic
959668827 3:108951400-108951422 AATTTTATTGTGTATGTCTAAGG - Intronic
960564755 3:119121560-119121582 TAGTTTCTTGTATATCTCTGAGG - Intronic
960914860 3:122684922-122684944 AGTTTTCTTGTCTATTTGTAAGG - Intronic
962486611 3:135849597-135849619 AATTTTATTGTGTATATTTAAGG - Intergenic
962870150 3:139481608-139481630 TAATTTCTTGTGTATCTTTCCGG + Intergenic
964143046 3:153425329-153425351 AATTTTGTTGTGAATCTGTCTGG - Intergenic
964443054 3:156731790-156731812 AAGTTTCTTTTTTGGCTGTAGGG - Intergenic
964681921 3:159350631-159350653 AATTTTATTGTGTATATTTAAGG + Intronic
964812517 3:160680925-160680947 AATTTTATTGTGTATATTTAAGG + Intergenic
964979869 3:162665716-162665738 GTGTGCCTTGTGTATCTGTATGG + Intergenic
970297227 4:14642816-14642838 ATTTTTCTTTTGTTTCTGTAGGG - Intergenic
970518102 4:16854261-16854283 AACTTTATTGTGTATATTTAAGG - Intronic
970856853 4:20659118-20659140 AGGATTCCTGAGTATCTGTAGGG - Intergenic
972939000 4:44174133-44174155 GACTTTTTTGTGTATGTGTATGG - Exonic
973091560 4:46143604-46143626 AACTATCTTGTGTATTTCTATGG + Intergenic
973929662 4:55778877-55778899 AAATTTATTGTGTATATTTAAGG - Intergenic
974362639 4:60902101-60902123 AAATTTATTGTGTATATTTAAGG + Intergenic
974504991 4:62758322-62758344 TAGTATCTATTGTATCTGTATGG - Intergenic
975200279 4:71579749-71579771 AATTTTATTGTGTATATTTAAGG - Intergenic
975599722 4:76086703-76086725 AATTTTATTGTGTATATTTAAGG - Intronic
975623829 4:76322163-76322185 AAGTTTATTGTGAATTTGTGGGG - Intronic
975754044 4:77554059-77554081 AATTTTATTGTGTATATTTAAGG - Intronic
977643787 4:99388221-99388243 AAATTTCTTGTGAATTTGTGTGG + Intergenic
977817150 4:101427852-101427874 CAGTTTCTTGGATATCTGTCTGG + Intronic
978218700 4:106242395-106242417 AGATTTCTTGTGTATCTGTAAGG + Intronic
978322840 4:107516909-107516931 ATATCTCTTGTGTATCTGGATGG - Intergenic
978424524 4:108568179-108568201 AGGTTTCTTGCATATCTGTTAGG - Intergenic
978611810 4:110549732-110549754 AGGCTTCTGGTGTATCGGTATGG + Exonic
979809753 4:125021912-125021934 CAGTTTCTTCTGTATCTTTGGGG - Intergenic
981195419 4:141914395-141914417 AAGCTTCTTGTGTAATTTTATGG + Intergenic
981683919 4:147431682-147431704 AATTTTATTGTGTATATTTAAGG + Intergenic
984020547 4:174479762-174479784 AATTTTGTTGTGAATCTGTCTGG - Intergenic
986393989 5:7310267-7310289 AATTTTCTTGTGTATAGTTAAGG + Intergenic
986524828 5:8662836-8662858 TTGTTTCTGGTGTGTCTGTAAGG + Intergenic
986549784 5:8939846-8939868 CAGTTTTTTGTATTTCTGTAGGG - Intergenic
988101107 5:26680045-26680067 AATTTTATTGTGTATGTTTAAGG + Intergenic
988395639 5:30694724-30694746 AGGTTTGTTGTTTATCAGTATGG + Intergenic
989539012 5:42597238-42597260 ATGTCTCTTATGCATCTGTATGG - Intronic
994617460 5:102123136-102123158 AATTTTATTGTGTATATTTAAGG + Intergenic
994780865 5:104088386-104088408 ATGTTTCTTCTATTTCTGTATGG - Intergenic
994834980 5:104839212-104839234 TTGTTTCTTCTGTATCTCTAAGG - Intergenic
995249499 5:109974722-109974744 GATTTTCTTGTGTATATTTAAGG + Intergenic
996536073 5:124579476-124579498 CAGTTTCTTGTATAACTTTATGG - Intergenic
1000680740 5:164181132-164181154 AATTTTATTGTGTATATTTAAGG - Intergenic
1004008476 6:11658358-11658380 ATGTTTCTTTTGTATATGTAAGG - Intergenic
1005694683 6:28340873-28340895 AAGTTTTTTGTTTTTCTTTAGGG + Intronic
1005937467 6:30534451-30534473 ATGTTTCTAGTGTATTTGTAAGG + Intergenic
1007814999 6:44515602-44515624 AATTTTATTGTGTATATTTAAGG + Intergenic
1008426620 6:51365464-51365486 AAGTTACTACTGTATTTGTATGG - Intergenic
1008504118 6:52212416-52212438 TACTTTCTTGTGTCTTTGTAGGG + Intergenic
1008782495 6:55124745-55124767 AAGTTTCTTGTAGGTCTCTAAGG + Intronic
1008897317 6:56571063-56571085 GAGTTTCCTGAGTCTCTGTAGGG - Intronic
1008923235 6:56864571-56864593 AATTTTCTTGTGTAGTAGTATGG - Intronic
1008995942 6:57659339-57659361 AATTTACTTCTGTTTCTGTAAGG + Intergenic
1009184469 6:60558117-60558139 AATTTACTTCTGTTTCTGTAGGG + Intergenic
1009611245 6:65944052-65944074 AAGTATCTCAGGTATCTGTATGG - Intergenic
1010759416 6:79705815-79705837 AATTTTATTGTGTATATTTAAGG + Intergenic
1011922637 6:92599924-92599946 GGGTTTTTTGTGTATCTGTGAGG - Intergenic
1012213338 6:96551425-96551447 AATTTTCTTTCTTATCTGTAGGG - Exonic
1012345762 6:98183696-98183718 AAGTTTCTTATGAATCTATCAGG - Intergenic
1012737347 6:102966053-102966075 AATTTTATTGTGTATCTTTGAGG - Intergenic
1013100294 6:106980759-106980781 CAATTTCTTGTGTATCTCTTTGG - Intergenic
1013474424 6:110494354-110494376 GAGTTACTGGTGAATCTGTATGG - Intergenic
1013566578 6:111370508-111370530 AATTTTATTGTGTATATTTAAGG + Intronic
1013897317 6:115104766-115104788 AATTTTATTGTCTATATGTAAGG - Intergenic
1015471691 6:133613356-133613378 AAGTTTCCTGTGAATTTGAAGGG - Intergenic
1016443060 6:144104386-144104408 TAGTTTCTTGTGTATCCTTTGGG + Intergenic
1017558005 6:155593687-155593709 TAGGTTCTTGTATTTCTGTATGG - Intergenic
1017857670 6:158365420-158365442 ATTTTTCTTGTGTATCTCTTTGG + Intronic
1020698229 7:11443624-11443646 AATTTTATTGTGTATATTTAAGG - Intronic
1020834968 7:13137686-13137708 TATTTTCTGGTGTATATGTATGG - Intergenic
1021397849 7:20172401-20172423 AAATCTCTTTTCTATCTGTATGG + Intronic
1021792867 7:24223913-24223935 GAGTTTGGTGTGTATCTCTAGGG + Intergenic
1022158411 7:27683217-27683239 AACTTTATTGTGTATATTTAAGG - Intergenic
1022937421 7:35193139-35193161 AAGTTTCATATTTATCTTTAGGG - Intergenic
1023319823 7:38982714-38982736 AATTTTCTTTTCTATCTCTAAGG + Intronic
1024323480 7:48091100-48091122 ATGTTTGTTGTTTATCTTTAGGG - Intronic
1024392753 7:48834243-48834265 AAGGTTCCTGTGTATGTGTTGGG + Intergenic
1025923078 7:65932764-65932786 AACTTCCATGTGTATTTGTAAGG + Intronic
1026520980 7:71118053-71118075 AAGTATCTTGTGGATCTGGGGGG - Intergenic
1027823938 7:83086816-83086838 ACGTTGCCTGTGTATCTGTTGGG - Intronic
1028100656 7:86816045-86816067 AAGTTTCATGAGTACCTGGAAGG + Intronic
1028372703 7:90112463-90112485 AAGTTTCATATTTATCTTTAGGG + Intergenic
1028603557 7:92629787-92629809 AATTTTCTTGTGGTTCTGTAGGG + Intronic
1029654025 7:101912621-101912643 AAGTTTCTTCTGTATCCCTCTGG + Intronic
1029833584 7:103285783-103285805 AAGTTTCATATTTATCTTTAGGG - Intergenic
1029898726 7:104016567-104016589 AAGTGTCTTCTGTGTCTGTAAGG - Intergenic
1030014548 7:105205604-105205626 AAGATTCTTGTACTTCTGTAAGG - Intronic
1030518413 7:110565980-110566002 AAGTTTCTTGTTCACCTCTACGG - Intergenic
1030907063 7:115198948-115198970 CATTATCCTGTGTATCTGTAGGG + Intergenic
1033344383 7:140515945-140515967 AAGTATTTTGTGTGTCTGTGTGG + Intergenic
1033528710 7:142242703-142242725 AAGTTTTTTGTTTATTTTTATGG - Intergenic
1034920420 7:155075595-155075617 AAGTTTCTTGTGTATCTGTTAGG + Intronic
1035545195 8:475776-475798 AATTTTTTTTTGTATATGTATGG + Intergenic
1036066404 8:5385799-5385821 AATTTTGTTGTGTATATTTAGGG + Intergenic
1038906265 8:31907020-31907042 AGGTTTCTTGTTTCTCTGTTGGG - Intronic
1040705536 8:50122116-50122138 AAGGTGTGTGTGTATCTGTATGG - Intronic
1041177103 8:55208052-55208074 ATGTTTATTGTGTATATTTAAGG + Intronic
1042247642 8:66723901-66723923 TAATTTTTTGTGTATCTGTAAGG + Intronic
1042754182 8:72191733-72191755 ATGTTTCTTCTGTTTCTTTAGGG - Intergenic
1043318362 8:78949460-78949482 ATTTTTCTTGTGTATCTGGCTGG - Intergenic
1044222397 8:89684649-89684671 AATTTTATTGTGTATATTTAAGG + Intergenic
1045171454 8:99674722-99674744 TAATTTTTTGTGTATCTGCATGG + Intronic
1045442257 8:102226360-102226382 AATTTTATTGTGTATGTTTAAGG - Intronic
1045471108 8:102513102-102513124 AAGATTTTTGTGTATCAATATGG - Intergenic
1045730971 8:105240314-105240336 AATTTTTATGTGTATATGTAGGG + Intronic
1046234751 8:111408565-111408587 AATTTTATTGTGTATATTTAAGG + Intergenic
1046603478 8:116344571-116344593 AAATTTTTTGCCTATCTGTATGG - Intergenic
1047021751 8:120782696-120782718 AACTTTTTCGTGTATCTGTTAGG - Intronic
1047076831 8:121413543-121413565 AAGTTTCTTGTTCCTCTTTAAGG + Intergenic
1047456213 8:125014955-125014977 ATGTTTGTTGTTTATCTGTCTGG + Intronic
1047671530 8:127152555-127152577 AATTTTCTTTGGTATCTATATGG + Intergenic
1048738100 8:137524208-137524230 AAGTCTCTTGCGTATCTATATGG + Intergenic
1048776221 8:137949488-137949510 AAGTTAATTGTGTATTTCTAGGG - Intergenic
1050199929 9:3133387-3133409 AAGTTTCTTATGCAATTGTACGG - Intergenic
1051261005 9:15264770-15264792 AATTTTATTGTGTATATATAAGG - Intronic
1051599118 9:18854431-18854453 AAGTTTCTTGTGTATCTGTATGG - Intronic
1051819392 9:21146967-21146989 AAGTTTTTTGTATTTCTGTGAGG + Intergenic
1052182957 9:25553237-25553259 AAGTTTCTGGTATATATGAAGGG + Intergenic
1052543628 9:29844225-29844247 AATTTGCCTGTGAATCTGTATGG - Intergenic
1055099000 9:72443654-72443676 ATGTATCTATTGTATCTGTAAGG - Intergenic
1055231418 9:74071171-74071193 GAGTTTCTTGTATTTCTGTGAGG + Intergenic
1056236031 9:84595485-84595507 AAGTTGTTTGTGTGTCTGTAAGG + Intergenic
1056340253 9:85623208-85623230 AAGTTTCTGGTGTTTCTTGAAGG - Intronic
1056918676 9:90766143-90766165 AATTTTCTTGTGTGTGTGGAAGG + Intergenic
1057511558 9:95684037-95684059 AATTTTATTGTGTATATTTAAGG - Intergenic
1058076691 9:100658372-100658394 AATTTTATTGTGTATCTTTGAGG - Intergenic
1059602087 9:115789917-115789939 GAGTTTCTAGTGTATGTTTAGGG + Intergenic
1059637979 9:116189386-116189408 AATTTTATTGTGTATATTTAAGG - Intronic
1186207153 X:7212897-7212919 ATGTTTCTTTTGTATGTGTAAGG + Intergenic
1186233270 X:7479303-7479325 GAGGTTCTTGTGTATATGAAGGG + Intergenic
1186677806 X:11837746-11837768 AGTTTTCTTGTGTATGTTTAAGG + Intergenic
1187040466 X:15589767-15589789 AATTTTATTGTGTATATTTAAGG + Intronic
1187567881 X:20470539-20470561 AATTTTATTGTGTATATTTAAGG - Intergenic
1187714280 X:22086659-22086681 TAGTTTCCTGTGTATATGTTGGG + Intronic
1191576491 X:62712201-62712223 AAGTTTGATTTGGATCTGTATGG + Intergenic
1192849540 X:74940341-74940363 GAGTTTGTTGTATTTCTGTAGGG + Intergenic
1193188593 X:78542401-78542423 AAGTTTTTTGTATTTCTGTGGGG + Intergenic
1193196435 X:78638106-78638128 AATTTTGTTGTGTTTCTGTCAGG + Intergenic
1193502276 X:82293581-82293603 AAACTTCTTGTGTATCTTTAGGG + Intergenic
1193518446 X:82499756-82499778 TAGTTTTTTGTGTATCTGCTAGG + Intergenic
1193603859 X:83542043-83542065 AAGTCTCTTCTGTAATTGTAAGG + Intergenic
1193634914 X:83937643-83937665 GAGTTTTTTGTGTATCTGTGGGG + Intergenic
1194916045 X:99710316-99710338 AAGTTTCTTGTTTGTCTCCATGG + Intergenic
1194961711 X:100243663-100243685 AATTTTATTGTGTATATTTAAGG - Intergenic
1195023513 X:100852667-100852689 AACTTCCTTGAGTATCTCTAGGG + Intronic
1195515154 X:105765637-105765659 AAGTTTCTTATTTATCTGTAGGG + Intronic
1195989872 X:110671894-110671916 TAGTTTCATGTATATCTTTATGG - Intergenic
1196166899 X:112545506-112545528 AGATTTCTGGTGTATCTGTGGGG - Intergenic
1196402773 X:115333492-115333514 AATTTTCTTGGGTATATATATGG + Intergenic
1196567058 X:117220400-117220422 ATATCTCTAGTGTATCTGTATGG - Intergenic
1197716272 X:129708403-129708425 AAGTTTCTTGTATATCGGCCTGG - Intergenic
1198339282 X:135698627-135698649 AATTTTCTAGTGCATCTGTGTGG - Intergenic
1200412994 Y:2879839-2879861 AATTTTCTTGTCTATCTGTCTGG - Intronic
1200506478 Y:4016281-4016303 AGGTTTTTTTTCTATCTGTAGGG + Intergenic
1200702228 Y:6412068-6412090 CAGATTCTTTTGGATCTGTACGG + Intergenic
1201031883 Y:9752630-9752652 CAGATTCTTTTGGATCTGTACGG - Intergenic
1201395457 Y:13543053-13543075 ATGTTTTTTGTGTTTCTGTGAGG - Intergenic
1201579003 Y:15491668-15491690 ATGTTTCTTTTGTGTGTGTAAGG + Intergenic