ID: 1051599125

View in Genome Browser
Species Human (GRCh38)
Location 9:18854475-18854497
Sequence AAGAGGAACCAGGTAGTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051599118_1051599125 21 Left 1051599118 9:18854431-18854453 CCATACAGATACACAAGAAACTT No data
Right 1051599125 9:18854475-18854497 AAGAGGAACCAGGTAGTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051599125 Original CRISPR AAGAGGAACCAGGTAGTTGA GGG Intronic