ID: 1051602507

View in Genome Browser
Species Human (GRCh38)
Location 9:18889475-18889497
Sequence CAGGGCAGGGAGAAGGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 761
Summary {0: 1, 1: 0, 2: 7, 3: 80, 4: 673}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051602507_1051602515 1 Left 1051602507 9:18889475-18889497 CCTGTCACCTTCTCCCTGCCCTG 0: 1
1: 0
2: 7
3: 80
4: 673
Right 1051602515 9:18889499-18889521 TCAGAAGGAATTCAGAGTGTGGG 0: 1
1: 0
2: 0
3: 24
4: 281
1051602507_1051602514 0 Left 1051602507 9:18889475-18889497 CCTGTCACCTTCTCCCTGCCCTG 0: 1
1: 0
2: 7
3: 80
4: 673
Right 1051602514 9:18889498-18889520 CTCAGAAGGAATTCAGAGTGTGG 0: 1
1: 0
2: 1
3: 24
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051602507 Original CRISPR CAGGGCAGGGAGAAGGTGAC AGG (reversed) Intronic
900177002 1:1295395-1295417 CAGGGCAGGGCCAAGGAGGCTGG - Intronic
900590928 1:3459517-3459539 GAGGGCCGGGAGCAGGTGAGAGG + Intronic
900622763 1:3594944-3594966 CAGGGCAGGGAGAGGGACTCAGG + Intronic
901432166 1:9223046-9223068 CAGGCCAGGGACCAGATGACTGG + Intergenic
902052902 1:13578217-13578239 GAGGACAGAGAGAGGGTGACTGG + Intergenic
902293328 1:15449270-15449292 CAAGGCAGGAAGAAGGGGAAGGG - Intergenic
902360943 1:15942323-15942345 AAGTGCAGGAAGAAGGTGAGGGG - Exonic
902841556 1:19077407-19077429 CAGGCTCGGGAGCAGGTGACAGG + Intronic
902978920 1:20109371-20109393 CAGCCCAGGGACAAAGTGACAGG - Intergenic
903142956 1:21350683-21350705 CAGGGCAGGGGGAAGGGTCCTGG - Intergenic
903165136 1:21514946-21514968 CAGGGAAGGGAGGAGAGGACAGG + Intronic
903228762 1:21909319-21909341 CAGGGCAGGCAGATGGAGCCTGG + Intronic
903284545 1:22268559-22268581 CAGGGCAGGGCGGGGGTGCCTGG + Intergenic
904052425 1:27647768-27647790 CAGGGCCGGGAGAAGGAGGAGGG + Intergenic
904099425 1:28011139-28011161 CAGGGCAGGAAGAGGGTTAGTGG + Intronic
904383395 1:30126079-30126101 CAGGGTGGGGAGAGGCTGACTGG + Intergenic
904488993 1:30846737-30846759 CTGGGCAGGAGGAAGGGGACTGG + Intergenic
904537682 1:31210720-31210742 CAGGCCAGGGAAAGGTTGACAGG + Intronic
904591265 1:31616827-31616849 CAGGGGAGGGAGACTGTGTCTGG + Intergenic
905632167 1:39524913-39524935 CAGGGAAGGGAGGAGGCGAAAGG + Intronic
906495230 1:46301012-46301034 TAGGGGAGGGAGAAGGGGAAAGG + Intronic
907405933 1:54253582-54253604 CAGGGCTGGGAGAAAGTGAGAGG - Intronic
908096723 1:60746862-60746884 CGGGGCAGGGGGATGGTGTCAGG + Intergenic
908394234 1:63710905-63710927 CAGGGCTGGGAGAAGGAAAATGG - Intergenic
909893307 1:81035284-81035306 GGGGGCAGGGAGAAGGAGAGTGG + Intergenic
912497596 1:110101559-110101581 CAGGGCAGAGCGAGGGTGAAAGG - Intergenic
912505447 1:110152602-110152624 CTGGGCAGGGAGATGGGGAGAGG + Intronic
913521230 1:119647683-119647705 GAAGGCAAGGAGAAGGTGAAGGG - Exonic
913969452 1:143403419-143403441 CAGGGCAGGGAGCAGGGTAGAGG - Intergenic
914063829 1:144229018-144229040 CAGGGCAGGGAGCAGGGTACAGG - Intergenic
914115321 1:144737336-144737358 CAGGGCAGGGAGCAGGGTACAGG + Intergenic
915099382 1:153487946-153487968 CATGGCAGAGAGAACTTGACTGG - Intergenic
915118747 1:153615724-153615746 CAGGGCAAGGCCAAGGTGAAGGG + Intronic
915230006 1:154438599-154438621 CAGGGCTGGGAGAAAGTGGCAGG - Intronic
915652901 1:157332211-157332233 CAGGGGAGGCAGAGGGAGACAGG - Intergenic
916680672 1:167102146-167102168 TAGGGCAGGGAGGGGGTGAGAGG + Intronic
916914008 1:169386044-169386066 AAGGGCAGGGATAACGTGCCTGG - Intronic
918143420 1:181736493-181736515 CAGGGCAGGGTGAAGGGGAGAGG + Intronic
918187211 1:182138670-182138692 TAGGGCACAGAGAAGGTGGCAGG + Intergenic
919932304 1:202229296-202229318 TGGGGCAGGGAGAAGGAGAAGGG - Intronic
920051239 1:203166248-203166270 CTGGGCTGGGAGAAGGTGCTTGG + Exonic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920286776 1:204885359-204885381 AAGGGGAGGGTGAAGGTGAAGGG - Intronic
920497325 1:206464572-206464594 GTGGGGAGGGAGAAGGTGGCTGG - Intergenic
920694175 1:208169229-208169251 AAGGGCAGGCAGGAGGTGACAGG + Intronic
920698706 1:208201494-208201516 CAGGGCTGGGAGTAGGGGACAGG + Intronic
921778584 1:219132796-219132818 CAGGGAAGAAAGAAGGTGACTGG + Intergenic
922212907 1:223499180-223499202 AAGAGCAGGGAGGAGGTGCCAGG - Intergenic
922730507 1:227946819-227946841 GAGGGCCGGGAACAGGTGACCGG + Intronic
922799703 1:228359666-228359688 CAGAGCAGCGGGAAGGTGAGCGG - Intronic
922822703 1:228494998-228495020 CAGGGCAGGGGGAAGAGGCCAGG - Exonic
922879377 1:228969178-228969200 CAAGGCAGTGAGAATGTGAAAGG - Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
924701980 1:246463343-246463365 CAGGTCAGGGAGAGGGAGAGAGG + Intronic
924737659 1:246772892-246772914 TGGGACAGGAAGAAGGTGACAGG - Intergenic
1062798776 10:363957-363979 CAAGGCAGGGAGAAGAAAACTGG + Intronic
1062923364 10:1296598-1296620 GAGGGCAGGGGGAAGGGGTCAGG + Intronic
1063636603 10:7788320-7788342 CGGGGCAGGGAGGAGGAGATGGG + Intronic
1064080157 10:12301891-12301913 CTGGGCAAGGAGCAGGTTACAGG + Intergenic
1064188702 10:13186450-13186472 GAGGGCAGGGGAAAGGTGAGGGG + Intronic
1064329396 10:14379518-14379540 GAGAGCTGGGAGAAGGTCACAGG + Intronic
1065188957 10:23193333-23193355 CAGCTCAGGGAGAAGGGGTCGGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1066653821 10:37681731-37681753 CACGGCTGGGAGAAGGTCAGGGG + Intergenic
1066654510 10:37685851-37685873 CAGGCCAGGGAGAGGTGGACAGG + Intergenic
1067278088 10:44851978-44852000 CAGGGCAGGGAGAATGCAGCCGG + Intergenic
1068764815 10:60751513-60751535 AAGAACAGGGATAAGGTGACTGG - Intergenic
1068829067 10:61472363-61472385 CAGGTCAGAGAGGAGGTGAGGGG - Intergenic
1069606140 10:69739960-69739982 CAGGGCAGGAAGAACGGGGCAGG - Intergenic
1069821335 10:71230534-71230556 GAGGGCAGAGAGAAGGTGGCTGG - Intronic
1069894342 10:71671329-71671351 CAGGCCAGCCAGATGGTGACAGG - Intronic
1070114772 10:73517635-73517657 CATGGCAGGAAGCAGGTGAATGG + Exonic
1070462597 10:76684849-76684871 CAGGGCAGGTGGTAGGTGTCTGG - Intergenic
1070516604 10:77213954-77213976 CAAGGCAGGGAGCAGATGACTGG - Intronic
1070560354 10:77561773-77561795 CAGAGAAGGGATAAGGTAACAGG + Intronic
1070598586 10:77849722-77849744 CAGGAAAGGGAGAGGGGGACAGG + Intronic
1070716273 10:78724338-78724360 GAGGGAAGGGAGGAGGTGCCAGG + Intergenic
1070961458 10:80502856-80502878 CAGGGCAGGGTGAAGGAGCTAGG + Intronic
1071503516 10:86219543-86219565 CAGAGCAGGGAGAAGGGGAGCGG - Intronic
1072266094 10:93729388-93729410 CTGGCCAAGGAGAATGTGACTGG + Intergenic
1072710803 10:97714497-97714519 GAGGGCAGGGAGAGGGTGCCAGG - Exonic
1072897195 10:99377059-99377081 CACTGCAGCGAGAAGGGGACCGG - Exonic
1074193501 10:111158734-111158756 CTGGGGTGGGAGAAGATGACTGG + Intergenic
1074339504 10:112613473-112613495 CAGAGAGGGGAGAAGGTGAAAGG - Intronic
1074721312 10:116267619-116267641 CAGGGCAGACAGTAGGTAACAGG + Intronic
1075070849 10:119319116-119319138 CAGGGCAGGAGGAAGGAGAGTGG - Intronic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075284490 10:121171803-121171825 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284497 10:121171821-121171843 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075284504 10:121171839-121171861 AAGGGAAGGGAGAAGGGGAAGGG + Intergenic
1075532553 10:123242010-123242032 CAGGGCAGGAAGGAGGTGCCAGG - Intergenic
1075553800 10:123414113-123414135 CAGGGCAGGGAGGGGCTGACTGG + Intergenic
1075602596 10:123781355-123781377 CAGGGCAGAGAGGAGAGGACAGG + Intronic
1075616072 10:123891679-123891701 CAGGGCAGGGTCACGGTCACCGG + Exonic
1075825878 10:125356729-125356751 CAGAGCAGGGAGGAGGGGAGAGG - Intergenic
1075901915 10:126049973-126049995 CAGGGCAGAAAGGAGGTGGCTGG + Intronic
1075914788 10:126157881-126157903 CAAGGCAGTGGGAAGGTGACAGG + Intronic
1076031905 10:127166412-127166434 CAGGGGAGAGAGAAGATGAGTGG + Intronic
1076136463 10:128048656-128048678 CAGGGCAGGGAACCGGGGACTGG - Intronic
1076478607 10:130769407-130769429 CTGGGCAGGGTGCAGGTGGCTGG - Intergenic
1076717892 10:132375762-132375784 CTGGGCAGGGAGCAGGGGAAAGG - Exonic
1076880871 10:133238469-133238491 CAGGGCAGGGAGGTGCGGACGGG - Intronic
1076921693 10:133457636-133457658 GAGGGCAGGGAGAAGGGGGGTGG + Intergenic
1077411601 11:2406346-2406368 CAGGGCAGGCAGTCGGGGACAGG + Intronic
1077485335 11:2835924-2835946 CAGGGCAGTGACAGGGTGATCGG + Intronic
1077554895 11:3221159-3221181 GAGGGGAGGGAGAAGGAGAATGG + Intergenic
1078654832 11:13229029-13229051 CAGAGCAAAGAGAAGGAGACTGG + Intergenic
1079104151 11:17559687-17559709 CAGGCCAGGAAGATGGTGCCAGG - Intronic
1079357715 11:19743779-19743801 CAGGACAGTGAGAAGCTGCCGGG - Intronic
1080425894 11:32154025-32154047 CAGGGCAGGAAGAAGGTCAATGG + Intergenic
1080550346 11:33369133-33369155 AAGGGAAGGGAGAAGGGGAGGGG - Intergenic
1080552246 11:33382809-33382831 CAGGGCAGGGAGAGGGTGCCAGG - Intergenic
1080603933 11:33848303-33848325 CAGAGCAGGAGGAAGGTGGCGGG - Intergenic
1080642913 11:34168151-34168173 CAGGGCATGGGGAAGGTGAGTGG + Intronic
1081872537 11:46390079-46390101 CAGGGCCGAGAGTGGGTGACCGG + Intergenic
1082786994 11:57322716-57322738 CTGGGCTGGGAGAACGGGACAGG + Intronic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083262658 11:61531511-61531533 GTGGGCAGGGAGAAGGGGAGAGG + Intronic
1083266751 11:61550439-61550461 GAGGGCAGGGGGAGGGTGGCTGG + Intronic
1083661929 11:64255465-64255487 CAGGGCAGGAGGAAGGTGCTGGG - Intronic
1083676671 11:64329734-64329756 CAGGGCAGGGACAGGGAGCCAGG + Intergenic
1083690311 11:64404396-64404418 TTGGGCAGGGAGAAGGTGTTGGG - Intergenic
1083796267 11:65018548-65018570 CTGGGCAAGGAGCGGGTGACAGG - Intronic
1085212201 11:74791413-74791435 CAGGGCAGGTTGATGGTGACAGG - Intronic
1085231334 11:74973675-74973697 CAGGACAGGGAGAGAGTAACTGG - Intronic
1085471583 11:76761765-76761787 CAGGGCAGGGGGTAGAGGACAGG + Intergenic
1086183222 11:83980936-83980958 CAGAGCAGGGATCAGGTGAAGGG + Intronic
1086200206 11:84193359-84193381 CAGGACAGAGAGAAGATGCCTGG + Intronic
1087020716 11:93600163-93600185 CAGGGAAAGAAGAAGATGACTGG + Intergenic
1087122498 11:94589594-94589616 CAGGGAAGGGAGCAGGGGAATGG - Intronic
1089303240 11:117511259-117511281 CAGGACAGGGAGGTGGTGCCAGG - Intronic
1089748328 11:120632587-120632609 AAGAGCAGGAAGAAGGTGGCTGG - Intronic
1090902562 11:131045880-131045902 CAGGGAAGGAAGGAGGTGGCGGG + Intergenic
1090952596 11:131486715-131486737 AAGGAAAGGAAGAAGGTGACAGG - Intronic
1091038573 11:132255804-132255826 CAGGGAAGGGGGAGGCTGACTGG - Intronic
1091752758 12:3032940-3032962 CAGGCCAGGGAGCAGAAGACAGG - Intronic
1091769611 12:3142397-3142419 CAGGGAAGGGAGGAGGCGAGAGG - Intronic
1091829495 12:3539675-3539697 CGGAGCAGGGAGAAGGAGATGGG - Intronic
1092326918 12:7542388-7542410 CAAGCCAGGGAGTACGTGACAGG - Intergenic
1092669871 12:10850934-10850956 CAGGGTCGGGGGAATGTGACTGG + Intronic
1092952609 12:13521295-13521317 CAGGGCTGGGAGTAGGAGATGGG + Intergenic
1095195027 12:39304272-39304294 CAAGGTAGAGAGAAGTTGACTGG - Intronic
1095712916 12:45309146-45309168 CATGAAAGGGAGAAGGTGATTGG + Intronic
1095984203 12:47988822-47988844 CTGGGCAGGGAAAAGGGCACAGG - Intronic
1096478245 12:51921626-51921648 CATGGCAGGGGGAAGGTCAGTGG + Intronic
1096694287 12:53338939-53338961 CAGGGCACTGGGAAGGAGACTGG - Intronic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1097270096 12:57768805-57768827 CAGTGGAGGGACAAGGTGAGAGG + Exonic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1101973585 12:109335299-109335321 CAGAGCAGGGAGCAGGTGTGGGG + Intergenic
1102176815 12:110882099-110882121 CAGCACAGGGAGAAGGTGTGTGG + Intronic
1102834420 12:116041158-116041180 GGGGCCAGGTAGAAGGTGACTGG + Intronic
1103480271 12:121246076-121246098 CAGGGCTGGGGGGAGGTGAATGG + Intronic
1104420152 12:128628231-128628253 AAGAGCAGGGAGGAGATGACCGG - Intronic
1104748037 12:131221992-131222014 CAGGGCTGGGGGAAGGTGGAGGG + Intergenic
1104906491 12:132215995-132216017 GAGGGAAGGGAGACGGTGGCGGG + Intronic
1105003169 12:132704192-132704214 CAGGGCAGTGGGATGGTGATGGG + Intronic
1105948353 13:25208668-25208690 AAGGGAAGGAAGAAGGTGGCGGG + Intergenic
1106076284 13:26464072-26464094 CAGGGCTGGAAGAGGGTGAGAGG + Intergenic
1106329239 13:28723953-28723975 CAGGCGATGGAGAAGGTGACAGG - Intergenic
1107432407 13:40351867-40351889 AAGGGAGGGGAGAAGGTGTCTGG - Intergenic
1108116647 13:47135997-47136019 CTGGGCAGGGACAAGGTTACTGG + Intergenic
1108291717 13:48968307-48968329 CAGAGGAGGAAGACGGTGACTGG + Intergenic
1109772646 13:66997344-66997366 AAAGGGAGGGAGAAGGTGCCAGG + Intronic
1110018477 13:70439176-70439198 CAGGGCAGGGAAAAGTGCACAGG - Intergenic
1110630218 13:77698280-77698302 CTAGGCAGGCAGAAGGTGCCCGG - Intronic
1110887313 13:80655527-80655549 CAGGGCAGGAGAAAGGTCACTGG - Intergenic
1112524305 13:100129532-100129554 CTGGTCAGGGAGAAGGTGGGAGG - Intronic
1112538880 13:100286455-100286477 CAGAGCAGGTAGCAGGTGATCGG + Intronic
1112716276 13:102189853-102189875 GAGAGCAGGGAGGAGGTGCCAGG + Intronic
1113109581 13:106807896-106807918 AAGGGCAGAGAGTAGGTGAAGGG - Intergenic
1113673922 13:112195566-112195588 CAGGGCAGAGAGACTGTGAAAGG - Intergenic
1114260751 14:21034466-21034488 CAGGGCTGGCTGAAGGTGGCTGG - Intronic
1114524504 14:23359548-23359570 CAGGGCAGGCAGAGGGCGGCGGG + Exonic
1114572671 14:23684482-23684504 CAGGTAAGGGATGAGGTGACAGG + Intergenic
1114646900 14:24260967-24260989 TCAGGCAGGCAGAAGGTGACAGG - Intronic
1117646631 14:57860070-57860092 CAGGGAAGGCAGAAAGTGAGAGG + Intronic
1117814598 14:59583793-59583815 CAGGGCAGGGAGTTGGTGCTGGG + Intergenic
1117991362 14:61436898-61436920 TAGAGCAGGGAGAAGGTACCAGG - Intronic
1118338979 14:64879476-64879498 GGGCGCAGGGAGAGGGTGACGGG - Intronic
1118796944 14:69152676-69152698 GAGGGCAGGAGGAGGGTGACGGG + Intronic
1118817588 14:69324057-69324079 CTGGGGAGGGAGGAAGTGACGGG + Intronic
1118849760 14:69574323-69574345 CTGGGGATGGAGAAGGTGCCTGG + Intronic
1118964869 14:70571390-70571412 AAGTGCAGAGAGAAGGTGGCGGG - Intergenic
1120193938 14:81463204-81463226 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193946 14:81463223-81463245 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193954 14:81463242-81463264 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120193962 14:81463261-81463283 CGGGGGAGGGAGAGGGAGACGGG + Intergenic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1120968803 14:90190817-90190839 AAGTGCATGGAGATGGTGACCGG - Intergenic
1121003090 14:90465976-90465998 CAGGGGAGAGAGAGGGAGACTGG + Intergenic
1121055678 14:90850165-90850187 CTGGGGAAGGAGAAGCTGACGGG - Exonic
1121688589 14:95858104-95858126 GAGAGCAGGGAGAAGGTGGGTGG + Intergenic
1121950031 14:98163628-98163650 CAGGGCAGGGAGGAGGGGACAGG - Intergenic
1122083053 14:99280190-99280212 CTGAGCTGTGAGAAGGTGACAGG + Intergenic
1122227336 14:100287365-100287387 AAGGGCAGAGAGAAGGGGGCAGG - Intergenic
1122307251 14:100773689-100773711 AGGGGCAGGGTGCAGGTGACTGG + Intergenic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122476031 14:102009660-102009682 CTGGGCTGGGAGAATGTGGCTGG + Intronic
1122635581 14:103128149-103128171 CAGGTAGGGGAGAAGGTGAGAGG + Intronic
1122817164 14:104319452-104319474 CAGGGTGGGGAGAGGGTAACAGG + Intergenic
1123003165 14:105307445-105307467 CAGGACAGGGAGGGGGTGAAGGG - Exonic
1123023621 14:105413365-105413387 CAGGGCAGAGCGGAGCTGACAGG + Exonic
1123193879 14:106597968-106597990 CAGGGGAGGGACCAGGTGAGAGG + Intergenic
1123758274 15:23413899-23413921 CAGAGCTGGGAGAAGGTCTCAGG + Intergenic
1124158034 15:27245207-27245229 CTGGGCAGGTAGCAGGTGCCAGG + Intronic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1125518667 15:40336586-40336608 CGGGGCAAGGAGAGGCTGACTGG - Exonic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1128384653 15:67138783-67138805 CAGGGAGGGGAGGAGGTGAGGGG - Intronic
1128495344 15:68195199-68195221 CAGGGCAGTGAGATGAGGACAGG - Intronic
1129258058 15:74345402-74345424 CAGAGCAGGGAGGAGGTGAGAGG - Intronic
1129269553 15:74412135-74412157 CAGGGCGAGGAGAGCGTGACTGG + Intronic
1129279204 15:74470531-74470553 CAGGGTAGGGAGATGGTTTCAGG + Intergenic
1129386706 15:75200472-75200494 CAGGGCAGGGACAGGGTCGCCGG + Intronic
1129460688 15:75698707-75698729 CAGGCAAGGGAGAAGCTGTCTGG + Intronic
1129680752 15:77657231-77657253 CAGGGGAGGGAGGAGGAGCCAGG - Intronic
1129724181 15:77893333-77893355 CAGGCAAGGGAGAAGCTGTCTGG - Intergenic
1129739521 15:77983511-77983533 CTGGGCAGGAAGAAGGAGAGGGG + Intergenic
1129798582 15:78396526-78396548 CAGTCCAGGGAGAAAGTGAGAGG - Intergenic
1130184112 15:81662714-81662736 CAGGGCATGATTAAGGTGACTGG + Intergenic
1130188411 15:81708584-81708606 CAGGGCATGATTAAGGTGACTGG + Intergenic
1130841243 15:87703279-87703301 CAGGGCAGGGAGAGAGGGAGAGG - Intergenic
1131078351 15:89513370-89513392 CAGTCCAGAGAGGAGGTGACTGG - Intergenic
1131296662 15:91155235-91155257 CAGGGGAGGAAGAAGGTGTAAGG + Intronic
1131370166 15:91874412-91874434 CAGGGCTGGGGGAAGGGGAGTGG - Intronic
1131671266 15:94621936-94621958 CAAGGCAGGGAGAATATGAGAGG + Intergenic
1131821994 15:96283133-96283155 AAGGGCAGAGAGAAGTTCACTGG + Intergenic
1132602301 16:778763-778785 CTGGGCAGAGAGGAGGAGACAGG + Intronic
1132617439 16:848742-848764 CTGGGCAGGGAGAAGGTGGACGG - Intergenic
1132879013 16:2153052-2153074 CAGGGCAGGGGGGTGGTGAGGGG + Intronic
1132926028 16:2429531-2429553 CAGGGCAGGCAGAAGGGGTGTGG - Intronic
1132932209 16:2464487-2464509 CAGGGCAGGGCCAAGGTCTCAGG - Intronic
1133255218 16:4512425-4512447 TAGGGCAGGGTGAAGAGGACAGG + Exonic
1133301195 16:4783870-4783892 CGGGGCAGGGAGGAGGAGAAGGG - Intronic
1133310010 16:4839132-4839154 AAGGGCGGGGAGAAGATGGCAGG + Intronic
1134079625 16:11315954-11315976 CAAGAGAGGGAGCAGGTGACAGG - Intronic
1134093473 16:11403867-11403889 CCGGGCAGGGAGAAGGGGCCAGG - Intronic
1134232598 16:12440154-12440176 AAGGGGAGGGAGGATGTGACAGG - Intronic
1134458064 16:14408995-14409017 CAGAGCTGGGAGAAGGTCTCAGG - Intergenic
1134581829 16:15377581-15377603 CAGGGCGGAGGGAAGGGGACGGG + Intronic
1135612341 16:23879393-23879415 CATGTCAAGGAGAAGGTGCCTGG - Intronic
1135770759 16:25216798-25216820 CAGGGCAGGGTGAGGGAGTCAGG - Intronic
1135890436 16:26352227-26352249 GAGGGCAGGCAGATAGTGACAGG - Intergenic
1136223461 16:28843773-28843795 CAAGTCAGGGAGAACATGACAGG + Exonic
1136370661 16:29834045-29834067 GACGGCAAGGAGAGGGTGACAGG + Exonic
1136779176 16:32886228-32886250 GAGGGCAGGGACAAGGTGGGCGG - Intergenic
1136891441 16:33975290-33975312 GAGGGCAGGGACAAGGTGGGCGG + Intergenic
1137585630 16:49662669-49662691 CAGGGCAGGAAAAGGGTGAAGGG + Intronic
1138198171 16:55069482-55069504 CAGGACAGGGAGGAGATGAGGGG - Intergenic
1138277436 16:55746035-55746057 GAGGGCAGGCAGAAGGAGAGAGG + Intergenic
1138420824 16:56898029-56898051 CAGGGCAGTGAGGAGCTGGCTGG - Intronic
1138505973 16:57478440-57478462 GAGAGAAGGGAGAAGGGGACAGG + Intronic
1138667777 16:58586413-58586435 GAGGGCAGGGAGGAGGGGAGGGG + Intronic
1139594418 16:67949761-67949783 CAGGGCAGGGGGATGGGGAAAGG - Intronic
1141156260 16:81599266-81599288 CAGGGGAGGGAGAGTGTGAACGG + Intronic
1141434762 16:83993752-83993774 CAGGGCCGGGAGATGGGGCCAGG + Intronic
1141618240 16:85222060-85222082 CAGGGCCTGGGGAAGGGGACAGG + Intergenic
1141635130 16:85310551-85310573 AAGGGCAGTGGGCAGGTGACAGG - Intergenic
1141859031 16:86704101-86704123 CATTGCAGGGAGAAGCTGATGGG + Intergenic
1142284287 16:89165454-89165476 CTGGGTAGGGAGAAGGGCACGGG - Intergenic
1142300782 16:89256808-89256830 AGGGGCATGGAGATGGTGACAGG - Intergenic
1142376635 16:89710052-89710074 CAGGGCAGGGAGTCCGGGACTGG + Intronic
1142759466 17:2034631-2034653 CAGGGGAGGGGGAAGGGGAGGGG - Intronic
1142957174 17:3529981-3530003 AAGGGCAGGGAGAAGAGGGCTGG - Intronic
1142957862 17:3533359-3533381 GAGGTGAGGGAGAAAGTGACTGG - Intronic
1143011712 17:3869629-3869651 GAGGGCAGGGAGAGGGGGAGAGG + Intronic
1143190150 17:5034628-5034650 CAGGACAGGGCAAAGGTCACAGG + Exonic
1143326697 17:6103687-6103709 CAGCGCACGGAGAAGGGGACTGG + Intronic
1143622592 17:8089353-8089375 CAGGATAGGGAGAAGGTGTTAGG + Intergenic
1143645015 17:8224283-8224305 GAGGCCAGGGAAGAGGTGACTGG - Intergenic
1143772312 17:9176508-9176530 CTGGAAAGGGAGAATGTGACTGG - Intronic
1144356412 17:14451120-14451142 CAGGGCAGAGACCAAGTGACAGG + Intergenic
1144763814 17:17722383-17722405 CAGGGCAGGGCCACGGTGAGGGG - Intronic
1144808656 17:17984553-17984575 CCTAGCAGGGAGAAGGTGATGGG + Intronic
1145722084 17:27082901-27082923 CAAGTCAGGGAGAACATGACTGG + Intergenic
1145783230 17:27577650-27577672 CAGGCAAGGGAGAGGGTGGCAGG - Intronic
1146318288 17:31826288-31826310 CAGGGCAGGAAGAAGGCAAGGGG + Intergenic
1146656187 17:34636565-34636587 CTGGGGAGTGAGGAGGTGACAGG + Intronic
1147305742 17:39563279-39563301 CAGGGTAGGGAGTGGGTGAGTGG + Intronic
1147458516 17:40553699-40553721 GAGGGCAGGGAGGAGGGGAGAGG + Intergenic
1147587084 17:41658905-41658927 CAGGGCAGGGAGGGGCTGGCAGG + Intergenic
1147943079 17:44064094-44064116 TTGGGCAGGAGGAAGGTGACAGG - Intronic
1148374604 17:47131530-47131552 GAGGGGAGGGAGAAGGGGAAAGG + Intronic
1148694223 17:49549421-49549443 CAGGGCAGGCAGAGGGAGAAAGG + Intergenic
1148811647 17:50296699-50296721 CAGGGGAGGGAGAAGGGTAGGGG + Intergenic
1149528625 17:57377537-57377559 CAGGTCACTGAGAAGGTGAAGGG - Intronic
1149667517 17:58376015-58376037 GAGGGCAGGAAGGAGGTGTCTGG + Intronic
1149677251 17:58477047-58477069 CAGCGCTGGGAGGAGGTGGCTGG - Intronic
1150122880 17:62618181-62618203 CAGGGGAGGGACAAAGTGAAGGG - Intergenic
1151000350 17:70368907-70368929 CAGGGCAGAGTGAAGGTGGGGGG + Intergenic
1151155068 17:72118314-72118336 CAGGTCAGGGAGGAGGGGTCGGG + Intergenic
1151299914 17:73216523-73216545 CAAGGCAGAGAGGAGGTGAGTGG + Intronic
1151820151 17:76492759-76492781 CAGGGCAGGGAGAGCGTGACAGG + Intronic
1152113403 17:78369914-78369936 CTGGGCAGGGAGAAGCTGCGGGG + Intergenic
1152318136 17:79592875-79592897 CTGGGCAGGGAGAAGGGGCAGGG - Intergenic
1152544549 17:80994233-80994255 CAGGTCAGGGAGCAGCTGCCAGG - Intronic
1152559015 17:81068646-81068668 CAGGGCAGGGAAGCGGGGACAGG - Intronic
1152571107 17:81121655-81121677 CCAGGCAGGGAGCAGGTGCCAGG + Exonic
1152592132 17:81218880-81218902 CAGGGCAGAGAGAAGGGGTCTGG - Intronic
1152991218 18:365612-365634 GAGGCAAGGAAGAAGGTGACAGG + Intronic
1153224404 18:2887527-2887549 GAGGGAAGGGAGAAGGTGCCAGG - Intronic
1153257995 18:3192078-3192100 CAGAGCAGGGAGAAGATGTTAGG + Intronic
1154411783 18:14145649-14145671 CAGGGCAGGGGTAAGGAGAGGGG + Intergenic
1155169746 18:23258687-23258709 CAATGCAGGGCAAAGGTGACTGG - Exonic
1156290876 18:35747843-35747865 GAGGGGAGGGAGCAGGGGACAGG + Intergenic
1157049497 18:44145301-44145323 CAGAGCAGGGACAAGCTGAGAGG + Intergenic
1157289231 18:46398310-46398332 CAGGGCAGGAAGAAGGAAGCAGG + Intronic
1157723548 18:49945068-49945090 CCGGGCAGGGAGAAGATTAGAGG - Intronic
1157804081 18:50645059-50645081 CAGGCCAGGGAGTGGGTGGCTGG + Intronic
1157816654 18:50734414-50734436 GAGGGCAGTGAGGAGGTGACAGG + Intergenic
1160106770 18:75985107-75985129 CAGGGCATGGAGGAGGGCACTGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160280568 18:77486052-77486074 CAGGGCAGGGAGTAGGACAGAGG - Intergenic
1160365623 18:78323772-78323794 CAGGGAAGGGAAATGGTGATGGG + Intergenic
1160500919 18:79400777-79400799 CGGGGCGGGGAGAGGGTGTCTGG - Intronic
1160581277 18:79885783-79885805 CAGGACAGGGAGATGGGGATGGG + Intronic
1160952269 19:1673504-1673526 CAGACCAGGGAGAGGCTGACTGG - Intergenic
1160975531 19:1790543-1790565 CAGTGGAGGGAGAAGGGGAGAGG - Intronic
1161134974 19:2614244-2614266 GAGGGCAGGGAGAGGGTGCTAGG - Intronic
1161287048 19:3474025-3474047 CAGGGCCTGGAGAAGGTGAGGGG + Exonic
1161334612 19:3706058-3706080 TAGGGCAGGGATGGGGTGACAGG + Intergenic
1161335048 19:3708516-3708538 CTGGGCAGGCAGCAGGTGCCAGG - Intronic
1161457222 19:4375405-4375427 CAGGGCAGGTGGAAGGGGAGGGG + Intronic
1161561148 19:4973045-4973067 CAGGTCAGGGCTATGGTGACTGG - Intronic
1161591641 19:5131643-5131665 GGGGGCAGGGAGGAGGGGACAGG + Intronic
1162080361 19:8214358-8214380 CCCCGCAGGGAGAAGGTGATGGG + Intronic
1162588650 19:11576954-11576976 GAGGGCAGAGGGAAGGTGATGGG - Intronic
1163078660 19:14919345-14919367 CAGGGTTGGGACAAGGTGATGGG + Intergenic
1163749087 19:19064672-19064694 CAGGGCAGAGGGCAGGTGCCAGG - Intronic
1163810845 19:19430442-19430464 GAGGGGCGGGAGAAGGTGAACGG + Intronic
1164684055 19:30155677-30155699 CAGGACGGGGAGCAGGTGGCTGG - Intergenic
1164847063 19:31441511-31441533 CAGGGTATGGGGCAGGTGACAGG - Intergenic
1165256692 19:34580546-34580568 CAGGGCAGGGAGGAAGAGACAGG - Intergenic
1165265894 19:34663847-34663869 CAGGGCAGGGAGGAAGAGACAGG + Intronic
1165386578 19:35513683-35513705 CTAGGTTGGGAGAAGGTGACAGG + Intergenic
1165504212 19:36214614-36214636 CAGGGGAGGCAGAAGGTGAGGGG - Exonic
1165673561 19:37701412-37701434 CAGAGCAGGTAGTAGGTAACTGG - Intronic
1166069945 19:40381173-40381195 CGGGGCATGGAGAAGGGGGCAGG + Intronic
1166103624 19:40586700-40586722 CAGGGCAGGGAGAAAGAAACAGG - Intronic
1166356491 19:42230434-42230456 CAGGGAAGGGAAGAGGAGACGGG + Exonic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166790446 19:45395895-45395917 GAGGGAAGGGAGAAGGGGATCGG + Intronic
1167721037 19:51180653-51180675 GTGGGCAGGGAGCAGGTGAGAGG - Intergenic
1167898757 19:52602302-52602324 CAGGGAAGAGAGAATGTAACAGG + Intronic
1167909310 19:52689360-52689382 CAGGGAAGAGAGAATGTAACAGG - Intronic
1167995239 19:53396258-53396280 CAGGGAAGAGAGAATGTAACAGG + Intronic
1168323091 19:55521845-55521867 CAGAGCTGGCAGAAGGTGGCAGG - Intergenic
925189813 2:1874000-1874022 CAGGGCACGAAGAAAGTGACAGG + Intronic
925360823 2:3278836-3278858 CTGTGCAGGGAGGAGGTCACGGG + Intronic
925798822 2:7575929-7575951 CAGGACAGTGAGAGGGTGAGAGG - Intergenic
925886044 2:8394432-8394454 CTGGGCAGGGGGAAGGTGAAGGG - Intergenic
925999657 2:9319988-9320010 CAGGGCAGGGAGTAGGGCACAGG + Intronic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926170133 2:10548026-10548048 TAGGGCAGGGACAAGGCCACGGG - Intergenic
926210000 2:10862580-10862602 GAGGGCAGGCAGACGCTGACTGG + Intergenic
927199315 2:20568562-20568584 GAGGTGAGGGAGGAGGTGACAGG + Intronic
928151822 2:28837821-28837843 CAGGGAGAGGAGAAGCTGACTGG + Intronic
928205067 2:29278168-29278190 CAGTGCAGGGAGGAGATGTCTGG + Intronic
929442399 2:41974213-41974235 CAGGGCAGGGAGAGGAGGAGAGG + Intergenic
929570002 2:43016715-43016737 GAGAGAAGGGAGAAGGTGCCAGG - Intergenic
930037003 2:47092554-47092576 GAGGGGAGGGAGAAGGGGAGGGG + Intronic
930037011 2:47092571-47092593 GAGGGGAGGGAGAAGGGGAGGGG + Intronic
930037019 2:47092588-47092610 GAGGGGAGGGAGAAGGGGAGGGG + Intronic
930302206 2:49630628-49630650 AAGGGCAGAGAGAAGGGGAAGGG + Intergenic
930997443 2:57737503-57737525 CAGAGCAGAAAGAAGGAGACTGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
932330173 2:70894292-70894314 AAGGGCAGGGAGAGGATGGCTGG - Intergenic
932568777 2:72925644-72925666 CCGGGCAGTGAGAAGATGCCCGG + Intronic
932621832 2:73269341-73269363 CAGGGCAAGGAGCAGGCGGCCGG - Exonic
932731400 2:74224599-74224621 CTGTCCAGGGAAAAGGTGACTGG - Intronic
933606356 2:84388624-84388646 CAGGCCTGGGAGACTGTGACAGG - Intergenic
933969904 2:87461933-87461955 CAGAGCAGGCAGATGGTCACAGG + Intergenic
934048091 2:88188245-88188267 CAGGGCAGGGCCAAGGTCACAGG + Intergenic
934174143 2:89564322-89564344 CAGGGCAGGGAGCAGGGTAGAGG - Intergenic
934284459 2:91638671-91638693 CAGGGCAGGGAGCAGGGTAGAGG - Intergenic
934769758 2:96900313-96900335 AGGGGCAGTGAGGAGGTGACCGG - Intronic
934990249 2:98915409-98915431 CAGGGCAGGGAGCAGGCCATGGG + Intronic
935191465 2:100781920-100781942 CTGGGGAGGGAGAAGGAGAGAGG - Intergenic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
935666343 2:105516223-105516245 CTGGCCAAGGAGATGGTGACAGG + Intergenic
935673381 2:105574121-105574143 CAGAGCAGAGGGAAGGTGGCTGG - Intergenic
935736552 2:106111121-106111143 CAGGACAGGGAGAATGAGAGTGG + Intronic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
936323877 2:111488563-111488585 CAGAGCAGGCAGATGGTCACAGG - Intergenic
936516615 2:113185277-113185299 CCAGGCAGGGAGAAGGGGAAAGG - Intronic
937106480 2:119319748-119319770 AAGGGTAGGGAGACAGTGACTGG + Intronic
937276852 2:120690459-120690481 GAGGTCAGGGAGGAGGGGACGGG + Intergenic
937313371 2:120915745-120915767 CAGGGCTGGGAGAGGCTGCCAGG - Intronic
937360199 2:121224300-121224322 CAGGGCTGGGAGCTGGAGACAGG + Exonic
937863859 2:126733318-126733340 GAGGGCAGGGAGGAGGGGGCAGG + Intergenic
937993994 2:127679608-127679630 TAGGGAAGGGAGAAGGTGGGGGG - Intronic
937998859 2:127716003-127716025 CAGGGCAGGGAGAGGAAGAGAGG + Intronic
938210222 2:129460728-129460750 CAGGCTATGGAGAAGGGGACAGG + Intergenic
938410117 2:131056598-131056620 CAGGGGAGGGAGAGGGTCTCTGG + Intronic
938467391 2:131532647-131532669 CAGGGCAGGCAGATGGGGGCGGG + Exonic
940164040 2:150748324-150748346 GAGGGGAGGGAGAAGGAGAGAGG - Intergenic
940682778 2:156807205-156807227 CAGTGTAGGGAGAAGATGACTGG - Intergenic
941051951 2:160745010-160745032 GAGGGCAGGGAAAAGGGTACAGG + Intergenic
941071969 2:160965735-160965757 CAGGGAAGGAAGAAGCTCACAGG - Intergenic
941736318 2:168980923-168980945 CAGGGTAGAGAGGAGGAGACTGG - Intronic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
944159073 2:196639860-196639882 CAGGACAGGGAGAGGGCGCCAGG - Intronic
946158077 2:217820001-217820023 AAGGGCAAGGAGAAGGTCAGGGG + Intronic
946220627 2:218222990-218223012 TAGGGCAGGCAGCAGGTGGCAGG - Intronic
947202507 2:227627274-227627296 CAGGGCAGGGGGATGGTTTCAGG - Intronic
947308717 2:228776780-228776802 CAGGTCAGGGAGAAGGGCACTGG + Intergenic
947711458 2:232318708-232318730 GAGGCAAGTGAGAAGGTGACAGG + Intronic
947769455 2:232659448-232659470 GAGGGCAGGGAGGGGGTGGCTGG + Intronic
947839290 2:233197471-233197493 CAGGGCAGAGAGATGGTGGGGGG - Intronic
948317074 2:237036156-237036178 CAGGGCAGGGCGGAGGTATCAGG - Intergenic
948502398 2:238405126-238405148 CTGGGAAGGGAGTAGGAGACAGG + Intergenic
948677581 2:239607835-239607857 GAGGACAGGGAGAAGGTTGCTGG + Intergenic
1169594943 20:7187893-7187915 CAAGGCAGGTGGAAAGTGACTGG + Intergenic
1170872066 20:20214877-20214899 CAGGGCAGGCAGAAGGAGAGTGG + Intronic
1171299761 20:24050131-24050153 CAGGGACCTGAGAAGGTGACCGG - Intergenic
1171367948 20:24639193-24639215 GCAGGCAGGGAGAACGTGACAGG + Intronic
1171377329 20:24702505-24702527 GGGGGCAGGGAGCAGGGGACAGG + Intergenic
1172117432 20:32581319-32581341 CAGGGCAGAGAGAGGGCGAGGGG - Intronic
1172605061 20:36208439-36208461 CCTGGCCGGGTGAAGGTGACTGG - Intronic
1173413579 20:42837071-42837093 ATGGGCAGGAAGAAGGAGACAGG - Intronic
1173451429 20:43167583-43167605 CAGAGCATGGTAAAGGTGACGGG + Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173896475 20:46554874-46554896 CAGGGCAGGGAGGAGGAGCATGG - Intergenic
1173908881 20:46649461-46649483 CAGAGCAGAGAGAAGCTGTCGGG + Intronic
1174361164 20:50029736-50029758 CAGGGCAGGGGCAAGGTGGGGGG - Intergenic
1174484857 20:50854848-50854870 CATGGCAGGAAGCAGGCGACAGG - Intronic
1175412203 20:58777739-58777761 CAGGGCAGGCAGCAGGGGCCAGG - Intergenic
1175550391 20:59813725-59813747 CAGGGCTGGGTGAGGGTGGCAGG + Intronic
1175612804 20:60365435-60365457 CAGGGCAGGGAGGGGCTGGCCGG - Intergenic
1175870212 20:62205812-62205834 CAGAGCGGGGTGGAGGTGACAGG - Intergenic
1175904749 20:62374238-62374260 CGGGGCAGTGGGAAGGTGACGGG - Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176121039 20:63454724-63454746 CAGGGGAGGGAGAGGGCGGCAGG + Intronic
1176922808 21:14708772-14708794 CAAGGCAAGGAGAAGGTGACTGG - Intergenic
1177933440 21:27314995-27315017 CAGGACATGGAAAAGGAGACAGG - Intergenic
1178336722 21:31750046-31750068 CAGGGCAGGCAGATGGTTAGAGG - Intergenic
1178440122 21:32591829-32591851 CAGGCCACTGACAAGGTGACAGG + Intronic
1178466506 21:32853444-32853466 CTGGGCAGGGAGGGGGTCACTGG - Intergenic
1179145910 21:38767144-38767166 CAGGGCTGGAAGCAGGTGAGGGG + Intergenic
1179275212 21:39885692-39885714 CAGGGGAGGGAGAGGGTGCCTGG - Intronic
1179967264 21:44814717-44814739 CAGGGCAGCGAGAAGGAGCCTGG - Intronic
1179987957 21:44931806-44931828 CGGGGCCAGGAGAAGGTGAGCGG - Intronic
1181059820 22:20276978-20277000 CAGGGCAGGAAGAGGTTGAGAGG + Intronic
1181429603 22:22870907-22870929 CAGGGCAGGGAGGAGCTGTAAGG + Intronic
1181438699 22:22924804-22924826 CAGGGCATGGAGAAAGGGAGAGG - Intergenic
1181625155 22:24118160-24118182 CAGGGGAGGGAGAAGGGCAATGG + Intronic
1181718329 22:24752333-24752355 CATGGCAGGGACAAGGAGAAGGG - Intronic
1181780731 22:25191016-25191038 CAGGCCAGGAGGCAGGTGACTGG + Intronic
1181960369 22:26618118-26618140 CTGGGCAGGGAGTGGGGGACTGG + Intergenic
1181971481 22:26693685-26693707 CAGGGCTGGGAGAAAGGGATGGG + Intergenic
1182151108 22:28027800-28027822 CAGGGCAGGGACAGGCTGGCAGG + Intronic
1182285888 22:29246703-29246725 CAGGCCAGGCTGAAGGAGACTGG + Intronic
1182558258 22:31140631-31140653 CAGGGCTGGCAGCAGGTGACTGG - Intergenic
1182623685 22:31631024-31631046 AAGGCCAGGGAGAAGGGGAAGGG + Intronic
1182960202 22:34465021-34465043 CAGGCCAGGCTGAAGGTGGCAGG + Intergenic
1183306525 22:37085901-37085923 GAGGGCAGGGAGGGGGTGAGGGG + Intronic
1183361990 22:37387633-37387655 CAGCCCAGGAAGAAGGTGGCAGG - Intronic
1183432507 22:37774296-37774318 TAGGGCAGGAAGAGGGTGGCAGG - Exonic
1183601424 22:38842695-38842717 CAGGGTAGGGAGGTGGTGAGGGG + Intronic
1184077849 22:42194705-42194727 CAGGGCATGGTGGAGGAGACTGG + Intronic
1184198441 22:42947851-42947873 TTGGCCAGGGAGAAGGTGACTGG + Intronic
1184287763 22:43481644-43481666 GAGGGGAGGGAGCTGGTGACAGG - Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184419559 22:44371768-44371790 CAGGACAGGGTGCAGGTGTCTGG - Intergenic
1184574458 22:45351119-45351141 CAGGGAATGGAGATGGTGAGTGG - Intronic
1184746348 22:46458384-46458406 CAGGGCAGGACGAGGGTGGCAGG + Intronic
1184769581 22:46589479-46589501 CTGCCCAGGGAGAAGGTGAGTGG + Intronic
1184806647 22:46798879-46798901 CAGGGCAGGGAGAGGGTTTCCGG + Intronic
1184912745 22:47547238-47547260 CAGCTCAGGGAGAAGATGACAGG - Intergenic
1185105968 22:48870055-48870077 CAGGGCAGAGAGAAGGGGAATGG - Intergenic
1185323980 22:50216637-50216659 CAGGGCAGGGACACGGTCAGGGG + Intronic
949097380 3:101404-101426 TAGGACAGGGTGAAGGTGAATGG - Intergenic
950105962 3:10388646-10388668 CAGGGCAGGTAGTAGGTGGTGGG - Intronic
950504485 3:13386035-13386057 AAGGGCTGGGAGAGGGTGAAGGG + Intronic
952597008 3:35029686-35029708 CAGGCCAGAGAGAAGGAGATGGG - Intergenic
952884442 3:38003866-38003888 CCAGGCTGGGAGAAGGAGACGGG - Intronic
953378102 3:42445695-42445717 CAGGGGAGGGACCAGGTGATTGG + Intergenic
953890512 3:46748891-46748913 CAGTGCAGGGACAGGGTGGCAGG + Intronic
953913660 3:46905118-46905140 CCTCGCAGGGAGATGGTGACAGG + Intergenic
954374215 3:50185613-50185635 CAGGGCAGGGAGGGGGTCCCTGG + Intronic
954648387 3:52145097-52145119 CAGGGAAGGGAGCTGGTGAGGGG - Intronic
954691484 3:52397863-52397885 CAGGGCCGGGAGGAGGTGGGTGG + Exonic
954701752 3:52454197-52454219 CAGGGCAGGGAGCAGACGAACGG + Intergenic
955004477 3:54956061-54956083 GAGGGGAGGGAGAAGGAGACAGG - Intronic
955085980 3:55703307-55703329 CAAGGCTGGGACAAGGAGACTGG - Intronic
955221078 3:57023833-57023855 CAGGGCAGTGAGCATGTGACAGG - Intronic
955350418 3:58189294-58189316 AGGGTCAGGGAGAAGGTCACTGG + Intergenic
955370841 3:58350433-58350455 CAAGTCAGGGGGAAGCTGACAGG - Intronic
955424108 3:58769332-58769354 CAGGGCTGAGAGAAGATGTCCGG + Intronic
956482788 3:69689591-69689613 CAGAGATGGGAGAAGGTGACAGG + Intergenic
956803429 3:72785030-72785052 CAGGGGAGGAAGAATGTGATTGG - Intronic
957305343 3:78450831-78450853 CAAGAGAGGGAGAAGGTGTCAGG + Intergenic
957610016 3:82453833-82453855 TAGAGCAGGGAGAAGGGGGCAGG - Intergenic
958446237 3:94218508-94218530 CAAGGAAGGGAGAAAGTGAAAGG + Intergenic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
959069268 3:101687396-101687418 CAGGGAAGGCAAAATGTGACTGG - Intergenic
959303670 3:104633293-104633315 AAGTTCAGGGAGAAGCTGACTGG - Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960734546 3:120764170-120764192 CAGGGAAGGAAGAAGGTGAAGGG - Intronic
960965862 3:123104307-123104329 CAGGGCAGAGGGAAGGGGACAGG + Intronic
961322114 3:126083675-126083697 CAGGCCAGGAAGGAGGAGACAGG + Intronic
961332933 3:126153657-126153679 CAGGGCTGGGAGAGGGAGAGGGG + Intronic
961529899 3:127534042-127534064 CAGGGCAGGGATCAGGAGACAGG - Intergenic
961632327 3:128310253-128310275 AAGGGTAGGGAGAAAGTCACAGG + Intronic
961657580 3:128451933-128451955 CAGTGCAGGGAGCAGGTGTCTGG - Intergenic
961712866 3:128840616-128840638 CAGCCCAGGGAGAAGGGGAGAGG + Intergenic
961735884 3:129001915-129001937 CCGGGCAGGCAGCAGGTGACGGG + Exonic
962110769 3:132444212-132444234 CAGGGCAGGGGGATGGTTTCAGG - Intronic
962204349 3:133422798-133422820 CAGGGTAGGGAGAAACTGTCCGG + Intronic
962345651 3:134617427-134617449 CAGGGGAGGTAGAAGGAGAGAGG + Intronic
962507028 3:136057511-136057533 AAGGGGAGGGAGAAGATGAAGGG + Intronic
962563479 3:136633077-136633099 CAGGGCATGGGGGAGGTGAAAGG + Intronic
963614580 3:147519592-147519614 GAGTGCAGGGAAGAGGTGACAGG - Intergenic
963793605 3:149609200-149609222 CAGGGCAGGGACAAGAACACTGG + Intronic
963861449 3:150314704-150314726 CAGGGCAGGTGACAGGTGACAGG - Intergenic
963936140 3:151055547-151055569 AAAGGCAAGGAGAAGGTAACTGG - Intergenic
964094349 3:152914298-152914320 CAGAGCATGGAGTAGGTGAGAGG - Intergenic
965207912 3:165745291-165745313 CAGCGGAGAGAGCAGGTGACAGG - Intergenic
965328113 3:167333221-167333243 AACTGCAGGGAAAAGGTGACTGG + Intronic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966075616 3:175933476-175933498 CAGGAAAGGGAGCAGGGGACAGG + Intergenic
966080080 3:175989699-175989721 CAGGGCAGGGAGATTGTTAGTGG + Intergenic
966149003 3:176845507-176845529 GAGGTCAAGGAGCAGGTGACTGG - Intergenic
966246404 3:177812814-177812836 CTGGGCAGGGAGGAGGAGCCAGG + Intergenic
966932950 3:184687546-184687568 CAGGGCAGGGAAATGGAGCCTGG - Intergenic
968075269 3:195812716-195812738 CAGGGCAGGGAGCTGGAGCCAGG + Intergenic
968126414 3:196163730-196163752 CAGGGCAGGAGGAGGGTGAGCGG + Intergenic
968229490 3:196996938-196996960 CCGGGCAGGAAGAGGGAGACGGG + Intronic
968490953 4:890247-890269 CAGGGCAGGGCCCAGGAGACCGG - Intronic
968961216 4:3744584-3744606 CAGGACCGGGAGAAGGGGTCTGG + Intergenic
968978550 4:3834591-3834613 CAGGGCAGGGCGGAGGTGTGAGG - Intergenic
969081769 4:4624640-4624662 CTGGGAAGGCAGAAGGTGAAAGG + Intergenic
969391514 4:6894584-6894606 TAGGGGAGGGAGGAGGAGACAGG + Intergenic
969599777 4:8169462-8169484 CAGACCAGGGAGCAGGTGAGGGG - Intergenic
969673652 4:8603139-8603161 CAGGGCAAGGAGAAGCTTAGAGG + Intronic
969870057 4:10098959-10098981 CAGGGCAGGGAGGGGCTGAGAGG + Intronic
969870531 4:10101749-10101771 CAGGGCACGGACAATGTGCCAGG + Intronic
971328871 4:25665886-25665908 CAGGGCAGAGAGACAGAGACAGG + Intronic
973580647 4:52341229-52341251 CAGGGCAGGGACCTGGTGAGAGG - Intergenic
973731003 4:53822238-53822260 CCAGGCAGGGAGAAGGTTGCAGG + Intronic
973818983 4:54645948-54645970 CCCAGCAGGGAGAAGGGGACAGG - Intergenic
974122986 4:57662589-57662611 CAGGAGAGGGAGAAGGAGAAGGG + Intergenic
974294164 4:59973117-59973139 GAGGGCAGGGAAAAAGAGACAGG + Intergenic
975271665 4:72442482-72442504 CAAGGCAGGAGGAAGGTGCCAGG + Intronic
976035035 4:80807875-80807897 AAGGGCAGGGAGGAGGTAAGGGG + Intronic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
976266585 4:83190912-83190934 CAGAGCAGGGACAAGGTCAATGG + Intergenic
976621457 4:87132382-87132404 CAATGCATGGAGAAGGTGCCTGG - Exonic
976744764 4:88391987-88392009 GAGGGGAGGGAGAAGGGGAGGGG - Intronic
976753830 4:88477481-88477503 GAGGGGAAGGAGAAGGTGAAGGG + Intronic
977459610 4:97308951-97308973 CAGGGGAGAGAGAAGGGGAAGGG - Intronic
977786599 4:101042338-101042360 CAGGGCAGAGGGAAGGTGGGAGG - Intronic
978739232 4:112118993-112119015 AAGGGAAGGGAGAAGGAAACAGG + Intergenic
980171502 4:129295293-129295315 CAGGGAAGGAGGAATGTGACTGG + Intergenic
981063424 4:140453600-140453622 CAGGGGAGGGAGTTGGTGAGAGG + Intronic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
982511906 4:156293008-156293030 CAGGGCAGGGAGAAAGACAAAGG - Intergenic
983654709 4:170071251-170071273 CAGGTGAGGGAGAGAGTGACAGG + Intronic
983739764 4:171114892-171114914 CAGGGAAGGGAGAAGCAGAGTGG - Intergenic
984574119 4:181427698-181427720 CATGACAGGGAGAAAGAGACGGG + Intergenic
984695244 4:182772333-182772355 CAGGGCAGGAAAACAGTGACAGG - Intronic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
986128896 5:4909216-4909238 CAGGGCATGGAGGAGCTGAATGG + Intergenic
986365249 5:7022563-7022585 CAGGAAAGAGAGAAGGTGGCAGG + Intergenic
986428433 5:7657548-7657570 CATGGCAGGGAGATGGTGTGGGG - Intronic
987062812 5:14258660-14258682 CTGGGGAGGTAGAAGGTGAGAGG - Intronic
988326796 5:29779024-29779046 GGGGGCCGGAAGAAGGTGACTGG - Intergenic
988993490 5:36693185-36693207 CAGGGCAGGGAGGAGGCCAGTGG - Intergenic
991259075 5:64647522-64647544 CAGAGCAGACAGCAGGTGACAGG - Intergenic
992816663 5:80447614-80447636 CAAGGCAGGAAGAAGGGGAGGGG - Intronic
993034267 5:82739853-82739875 AAGGGAAGGGAAGAGGTGACAGG + Intergenic
995194516 5:109348763-109348785 GAGGGCAGGGAAAATATGACTGG + Intronic
995762974 5:115583704-115583726 CAGGGCTGGGAGGAAGTGAGAGG + Intronic
995837501 5:116413207-116413229 GAGGGTGGTGAGAAGGTGACAGG - Intergenic
995917788 5:117270434-117270456 CAGGCCAGTTAGAAGATGACTGG + Intergenic
996949725 5:129110965-129110987 CAGGGCAGGCAGCTGGTGATGGG + Intronic
997457441 5:134027684-134027706 GTGGGCAGGGAGAAGATCACGGG - Intergenic
997597067 5:135114133-135114155 CAGGGCAGAGAGAAGCCGCCAGG + Intronic
997608360 5:135192598-135192620 TAGGGGAGAGAGAAGGTGTCTGG - Intronic
998059088 5:139105029-139105051 CAGGGCAGGGATAGGGCGGCAGG + Intronic
998228486 5:140344758-140344780 AAGGGGAGGGAGAAGGTGCAGGG + Intronic
999068544 5:148717497-148717519 CAGGAGAGGCAGAAGGTGAAGGG - Intergenic
1000362537 5:160461249-160461271 CAGGGCAGGGGGATGGTTTCTGG + Intergenic
1000363714 5:160471947-160471969 CAGGGAAGGGAGATGATCACTGG + Intergenic
1000880753 5:166694092-166694114 CAGGGCTGGGAGTAGGTAAAAGG - Intergenic
1001223491 5:169924135-169924157 CTGTGCAGGGAGAAGCAGACTGG - Intronic
1002185590 5:177453455-177453477 CAGGCCCAGGAGAAGGGGACTGG + Intronic
1002661030 5:180791271-180791293 CAGGTCAGGGAGAAGGGGTCTGG + Exonic
1002787474 6:414531-414553 GAGGCCTGGTAGAAGGTGACTGG + Intergenic
1003201606 6:3966314-3966336 GAGGCCTGGTAGAAGGTGACTGG + Intergenic
1003343971 6:5248257-5248279 CAGCACAGGGAGAAGGGGACTGG - Intronic
1004491621 6:16122629-16122651 CAGGGTAAGGAGAAGCAGACTGG + Intergenic
1004603515 6:17173423-17173445 CAGGCAAGGGAGAAGGGGAAGGG + Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005387116 6:25296241-25296263 CAGGACAGGGAGATAGTGAAAGG - Intronic
1006058788 6:31404406-31404428 ATGGGCAGGGAGGAGGTGAGAGG - Intronic
1006071276 6:31499291-31499313 ATGGGCAGGGAGGAGGTGAGAGG - Intronic
1006363517 6:33600879-33600901 CAGGGCAGGCTGGAGGTGCCAGG + Intergenic
1007343527 6:41209275-41209297 CAGGGAAGGAAGCAGGTGACAGG - Intergenic
1007346777 6:41236917-41236939 CAGGGAAGGAAGCAGGTGACAGG + Intronic
1007770112 6:44185504-44185526 CAGAGCAGGTAGCAGGTGATTGG - Intergenic
1007924920 6:45643025-45643047 GAGGGCAGAGAGAAGGGGAAAGG - Intronic
1008294905 6:49763674-49763696 TAGGGCAAGGAGAAGTTGAAGGG - Intergenic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1010314893 6:74436557-74436579 CTGGTCAGGGAGTGGGTGACTGG - Intergenic
1011216137 6:85007827-85007849 GAGGGTAGGGAAAAGGTGAAGGG + Intergenic
1011663013 6:89610269-89610291 CGGGGCTGGGAGAGGGTGACTGG - Intronic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013599855 6:111693713-111693735 CAGAGCAGGGAGAGGGAGAGTGG - Intronic
1014653827 6:124074244-124074266 CATGCCAGGCAGAAGGTGTCGGG - Intronic
1015520883 6:134130202-134130224 CAAGACAGGGAGGAGGTGCCAGG - Intergenic
1015880099 6:137863764-137863786 CAGTGCAGGGAAAAGGGGAGGGG + Intergenic
1016687149 6:146894798-146894820 CAGGGAAGGGTAAAGGTTACTGG + Intergenic
1018158733 6:161015693-161015715 CGGGGCGGGGGGAAGGTGCCAGG + Intronic
1018276332 6:162135711-162135733 CAGAGAAGGTAGAAGGTGAAAGG + Intronic
1018549666 6:164981303-164981325 CAGAGCAGAGAGAAGGGGAAAGG + Intergenic
1018648737 6:165972980-165973002 AAGGGGAGGGAGACGGTGAGGGG - Intronic
1019021100 6:168918414-168918436 CATGGCAGAGAGAAGCTGCCAGG - Intergenic
1019164801 6:170091132-170091154 CAGGGCAGGGAGCAGGGCAGGGG - Intergenic
1019192287 6:170259342-170259364 CAGGGCAGGGAGGAGGTGCCAGG - Intergenic
1019413244 7:915750-915772 CAGGGCCAGGAGGTGGTGACAGG - Intronic
1019447876 7:1080926-1080948 AAGGTCGGGGAGAAGGTGCCAGG + Intronic
1020282858 7:6659145-6659167 CAGGGCAGGGAGGAGGACAAGGG - Intergenic
1020604896 7:10324946-10324968 CATGGAAGGGACCAGGTGACAGG + Intergenic
1022274470 7:28841927-28841949 CAGGGAAGGGAGGAGGGGAAGGG + Intergenic
1022829829 7:34054825-34054847 GAGGGCAGGAAGAAGGAAACTGG + Intronic
1022923511 7:35038004-35038026 CGGGGCAGGGAGAAGGCGCCCGG + Exonic
1023024350 7:36037213-36037235 AAGGGCTGGGAGAGGGAGACTGG + Intergenic
1023129062 7:36984459-36984481 CAAGGCAGGGTGAGGGCGACTGG - Intronic
1023358835 7:39395372-39395394 GAGGGCAGTGAGAAGGTGAGAGG - Intronic
1023539935 7:41254185-41254207 CAGGGCAGAGAAAAAGTGTCAGG + Intergenic
1023599686 7:41869371-41869393 TAGGGCAGGTAGTAGTTGACAGG - Intergenic
1023940807 7:44767430-44767452 CAGGGCCGGGATGTGGTGACAGG + Intronic
1024777064 7:52799846-52799868 AAGTGCGGGGAGAACGTGACTGG + Intergenic
1025871768 7:65440960-65440982 CAGTGCAGGGGGCAGGTGTCTGG - Intergenic
1026037497 7:66840158-66840180 CAGGACAGTGAGCAGGTGCCTGG - Intergenic
1026209407 7:68290331-68290353 CAGGGCAGGGGTTAGGGGACAGG + Intergenic
1026643808 7:72150638-72150660 CAGAGCAGAGAGAACGTGAGAGG + Intronic
1027233905 7:76286797-76286819 CTGGGGAGGGAGCAGCTGACAGG + Exonic
1027514389 7:79123962-79123984 CAGGACAGTGAAAAGGTGAGGGG - Intronic
1027779912 7:82507939-82507961 CTGGAGGGGGAGAAGGTGACAGG + Intergenic
1027802150 7:82767991-82768013 GAGGGAAGGGAGAAAGAGACAGG + Intronic
1028556816 7:92134279-92134301 CAGGCGATGGAGAAGGTGACAGG - Exonic
1028726223 7:94090767-94090789 CAGCACAGGGCGGAGGTGACCGG - Intergenic
1028835110 7:95366069-95366091 CAAGGAAGGGAGAAGGTTATGGG - Intronic
1028994629 7:97086162-97086184 CAGGGCAGGTAGAGGGAGGCAGG + Intergenic
1029236551 7:99124499-99124521 CAGGGAAGGGAAAACGGGACAGG + Intronic
1029409814 7:100401825-100401847 CAGGGAGGGGAGATGCTGACAGG + Intronic
1029543093 7:101196099-101196121 CACTGCAGGGAGAGGGAGACAGG + Exonic
1029638667 7:101803981-101804003 TGGGGCAGAGAGAAGGTCACAGG - Intergenic
1029694671 7:102204927-102204949 CCGGGCCGGGAGCAGGTGAAAGG - Intronic
1029730601 7:102435471-102435493 GAGGGCAGGGAGCAGAGGACTGG - Intronic
1030338166 7:108347873-108347895 CAGGGCAGGGCTAAGGTGGAGGG - Intronic
1030957480 7:115872912-115872934 CAGGTCTAGGAAAAGGTGACTGG + Intergenic
1032447664 7:131998623-131998645 CAGGGCATGGAGAAGGAGAGGGG + Intergenic
1032496749 7:132368532-132368554 CTGGGCAGACAGAGGGTGACAGG - Intronic
1032679639 7:134168539-134168561 CAGAGAAGGGAGATGGTGAATGG + Intronic
1032708639 7:134443579-134443601 CAGGGCAGGGAGCACATGGCAGG + Intronic
1032868802 7:135957808-135957830 CAAGGGAGGGAGGAGGTGCCAGG - Intronic
1033021002 7:137724205-137724227 CAAGCGAGGGAGGAGGTGACAGG + Intronic
1033153048 7:138933188-138933210 CAGGGAAGGGAGATGGTACCTGG + Intronic
1033359198 7:140626234-140626256 CAGGGGACGGAGAAGGGGAAGGG - Intronic
1034073903 7:148213738-148213760 CAGGGGAGGGAGGAGGAGTCAGG - Intronic
1034221401 7:149449243-149449265 CAGGGCCTGGAGATGGTGACTGG + Intronic
1034391593 7:150791715-150791737 GAGGGAAAGGAAAAGGTGACAGG + Intronic
1034471806 7:151258744-151258766 CAGGGCAGAGAGAAGGTGGCGGG - Intronic
1034474883 7:151276380-151276402 CTCGGCAGGGGGGAGGTGACAGG + Intronic
1035004301 7:155644082-155644104 CCGGGCGCGGAGAAGGGGACGGG + Intronic
1035118000 7:156540921-156540943 CAGGCCAGGAAGCAGGTGGCAGG + Intergenic
1036129681 8:6097565-6097587 CAGGGAAGGGAGAAAGAGAGAGG + Intergenic
1036684374 8:10899472-10899494 CAGGTCAGGGAGAAGCTAACTGG - Intronic
1037261354 8:17012504-17012526 CAGGGCAAGTAGGAGGTGACTGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1038174718 8:25170045-25170067 CAGGACAGGGAGCTGGTGAGTGG - Intergenic
1038584863 8:28779330-28779352 CAGGCCAGGCAGAAAGTGCCAGG - Intronic
1039404780 8:37303155-37303177 CAGGGCAGGCAGGAGCAGACAGG + Intergenic
1039443427 8:37611471-37611493 CAGAGCAGGAAGAGGGGGACAGG + Intergenic
1039494248 8:37968893-37968915 GAGGGCAGGGAGAAGGGAAGAGG - Intergenic
1041060912 8:54033518-54033540 CAGGGCAGGGAGGAAGTGCCAGG + Intergenic
1041214246 8:55584007-55584029 GAGGGCAGGGAAAAGATGAGTGG + Intergenic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041279818 8:56198390-56198412 CAGGGGAGGAAGGAGGTGACGGG + Intronic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041703224 8:60815452-60815474 AGGGGCAGGGAGAGGGTGATGGG + Intronic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1043198137 8:77326856-77326878 CAAGGAAGGGACATGGTGACAGG + Intergenic
1044728553 8:95212532-95212554 CAGGGGAAGGAGCAGGTGAGGGG + Intergenic
1047811517 8:128414905-128414927 CAGGGGAAGGAGAAAGTGAAGGG + Intergenic
1048496511 8:134940277-134940299 CAGGGCAGGGGGCAGGTGGGGGG + Intergenic
1048991239 8:139761486-139761508 CAGGGCTGGGAGCAGGGAACTGG - Intronic
1049270479 8:141693077-141693099 CAGGCCAGAGAGGAGGAGACAGG + Intergenic
1049392028 8:142376673-142376695 CATGGCCTGGAGAAGGTGTCAGG + Intronic
1049552068 8:143264679-143264701 CAGGGAGGTGTGAAGGTGACGGG - Intronic
1049617103 8:143580418-143580440 GAGGGCAGGGGGAGGGTCACAGG + Intronic
1049654392 8:143791389-143791411 CAGGGCTGGGAGATGGTTCCAGG + Exonic
1051469986 9:17427207-17427229 CAGAGCACGGAGCATGTGACTGG - Intronic
1051602507 9:18889475-18889497 CAGGGCAGGGAGAAGGTGACAGG - Intronic
1051798548 9:20904470-20904492 CAGGGATGCGAGAAGGTTACAGG - Intronic
1052433223 9:28393784-28393806 CAGGGCAGGTCAAAGGTGCCAGG + Intronic
1053103587 9:35391627-35391649 CAGGCCAGGGAGGAGGTCATTGG + Intronic
1053884928 9:42636860-42636882 GGGGGCAGTGAAAAGGTGACAGG - Intergenic
1054223949 9:62444311-62444333 GGGGGCAGTGAAAAGGTGACAGG - Intergenic
1055455278 9:76466212-76466234 CAGGGCAGGGAGGAAATGAGGGG + Intronic
1056467614 9:86873479-86873501 CTGGCCAGGGAAAACGTGACAGG + Intergenic
1056791910 9:89631457-89631479 CAGGACAGGGAGGAGGTGCCTGG + Intergenic
1057761732 9:97880055-97880077 CTGGGCAGGTAGAAGCAGACTGG - Intergenic
1058201500 9:102047651-102047673 CAGGGGAGGGACAAGGTGGGAGG + Intergenic
1058972257 9:110094577-110094599 CAGGGCAGGAAGAAAGGGAGTGG + Intronic
1059218784 9:112592096-112592118 CAGAGCAGGTAGCAGGTAACTGG + Intronic
1059381957 9:113933851-113933873 CATGGCAGGGCAAGGGTGACAGG + Intronic
1059477804 9:114561823-114561845 CAGGGGAGGGTGAAAGTGTCTGG - Intergenic
1059715237 9:116907240-116907262 CAGGCCAGGGAAAAGGGAACGGG - Intronic
1059934632 9:119297348-119297370 CAGGGCGCTGAGAAGGTGAAGGG - Intronic
1060068740 9:120528115-120528137 CAGGGCTGGGTGAAGGGGAAGGG + Intronic
1060527198 9:124327312-124327334 CAGGGCGAGGAGAAGGAGATTGG - Intronic
1060554478 9:124501212-124501234 CCTGGCAGGGAGATGGTGACCGG + Intronic
1061413024 9:130431238-130431260 CAGGACAGGGAGAAGGAGCAGGG + Intronic
1061479986 9:130892925-130892947 CATGGCATGGAGAAGGGGATCGG + Intergenic
1061539212 9:131268494-131268516 GTTGGCAGGGAGAAGGTGTCTGG - Intronic
1061544198 9:131294466-131294488 CTCGGGAGGGAGAAGGGGACAGG - Intronic
1062239128 9:135526470-135526492 CAGGGCAGGGGGAAGGCGGGGGG - Exonic
1062573871 9:137197685-137197707 CAGGGGAGGGAGAGGCAGACAGG + Intronic
1062655775 9:137604218-137604240 CAGGTCAGGGAGGAGGAGTCTGG - Intergenic
1062686613 9:137816967-137816989 CAGGGCTGGGGGAAGGTGGTTGG - Intronic
1062686629 9:137817013-137817035 CAGGGCTGGGGGAGGGTGGCAGG - Intronic
1185464383 X:346137-346159 CAAGGCAGGGGGCAGGGGACAGG + Intronic
1185626688 X:1487624-1487646 GAGGGCAGGGAGGATGAGACAGG - Intronic
1186896873 X:14012545-14012567 CAGGGTAGGTCGCAGGTGACAGG - Intronic
1187492035 X:19761135-19761157 CAGGAGAGGGAGAAGGAGAGAGG + Intronic
1187715388 X:22097455-22097477 CAGAGCAGGAAGAAGGTGAAAGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188072216 X:25730493-25730515 CAGGGCAGGGAAAAGAAAACAGG + Intergenic
1189561367 X:42194563-42194585 GAGGACAGGGAGAAGGACACTGG - Intergenic
1189760322 X:44315523-44315545 CAAGGCAGAGAGAGGGAGACTGG + Intronic
1190559483 X:51672938-51672960 AAGGGCAGGTTGAAGTTGACAGG + Intergenic
1190564808 X:51720383-51720405 AAGGGCAGGTTGAAGTTGACAGG - Intergenic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1192805652 X:74506289-74506311 CAGGGTAGGGACAAGGTCTCAGG - Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1193329768 X:80223114-80223136 CAGGGCAGGGATATAGTGGCAGG + Intergenic
1193908760 X:87277024-87277046 CAGGGTGGGGAGAAGGCGAAGGG - Intergenic
1194696788 X:97062515-97062537 AAGGACAGGGAGATGGTGTCAGG + Intronic
1194721626 X:97346981-97347003 CAGAGAAGGAAGAAGGTGATGGG - Intronic
1195244177 X:102980815-102980837 CTGGGCAGGGAGAAGGCAACTGG - Intergenic
1195681459 X:107550015-107550037 CAGGGAAAGGACAAGGAGACCGG - Intronic
1195846630 X:109236230-109236252 CAGGGCAGGTAGCAGGTAATTGG + Intergenic
1196862444 X:120040829-120040851 CAGGGGCAGGAGGAGGTGACAGG + Intergenic
1196880658 X:120195515-120195537 CAGGGGCAGGAGGAGGTGACAGG - Intergenic
1197918605 X:131563405-131563427 AAGGGCAGGGGCAAGGTGAAGGG - Intergenic
1198161267 X:134010970-134010992 CAGAGCAGGGGGCAGGTGTCTGG + Intergenic
1199482087 X:148308937-148308959 CCGGGCAGGGAGAAGGTTGTGGG + Intergenic
1199880876 X:151973741-151973763 CAGGGCGAGGAGAAGGTGTGAGG + Intronic
1200100584 X:153687772-153687794 GAGGGCAGGGAGGAGGTGGGCGG + Intronic
1200135816 X:153874056-153874078 CTGGGGAGGGAGATGGTGACAGG + Intronic
1201270052 Y:12245765-12245787 CAAGGCAGGGGTAACGTGACAGG - Intergenic
1202267264 Y:23033367-23033389 TTGTGCAGGGAGAAGGAGACTGG - Intergenic
1202420256 Y:24667111-24667133 TTGTGCAGGGAGAAGGAGACTGG - Intergenic
1202450530 Y:25002971-25002993 TTGTGCAGGGAGAAGGAGACTGG + Intergenic