ID: 1051602574

View in Genome Browser
Species Human (GRCh38)
Location 9:18889823-18889845
Sequence GCCCTTCAGTAGCACTGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 103}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051602563_1051602574 22 Left 1051602563 9:18889778-18889800 CCCCACCCTAGGAGGAGCCCTCC 0: 1
1: 0
2: 1
3: 14
4: 201
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602564_1051602574 21 Left 1051602564 9:18889779-18889801 CCCACCCTAGGAGGAGCCCTCCC 0: 1
1: 0
2: 0
3: 16
4: 156
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602568_1051602574 5 Left 1051602568 9:18889795-18889817 CCCTCCCTGTTAGCGAAGTCAGT 0: 1
1: 0
2: 0
3: 2
4: 55
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602571_1051602574 1 Left 1051602571 9:18889799-18889821 CCCTGTTAGCGAAGTCAGTGGCC 0: 1
1: 0
2: 0
3: 2
4: 59
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602562_1051602574 25 Left 1051602562 9:18889775-18889797 CCTCCCCACCCTAGGAGGAGCCC 0: 1
1: 0
2: 3
3: 36
4: 281
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602565_1051602574 20 Left 1051602565 9:18889780-18889802 CCACCCTAGGAGGAGCCCTCCCT 0: 1
1: 0
2: 3
3: 22
4: 219
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602566_1051602574 17 Left 1051602566 9:18889783-18889805 CCCTAGGAGGAGCCCTCCCTGTT 0: 1
1: 0
2: 4
3: 19
4: 200
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602569_1051602574 4 Left 1051602569 9:18889796-18889818 CCTCCCTGTTAGCGAAGTCAGTG 0: 1
1: 0
2: 0
3: 4
4: 52
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602567_1051602574 16 Left 1051602567 9:18889784-18889806 CCTAGGAGGAGCCCTCCCTGTTA 0: 1
1: 0
2: 0
3: 33
4: 161
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103
1051602572_1051602574 0 Left 1051602572 9:18889800-18889822 CCTGTTAGCGAAGTCAGTGGCCA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG 0: 1
1: 0
2: 1
3: 10
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051602574 Original CRISPR GCCCTTCAGTAGCACTGTGC AGG Intronic
900324102 1:2099491-2099513 CCCCTTCAGAAGCAGTGGGCGGG + Intronic
900674708 1:3877816-3877838 GCACCTCAGTTCCACTGTGCCGG + Intronic
904164514 1:28545102-28545124 GCCCTTTAGTGGCCCTGTCCGGG + Intergenic
904456366 1:30650568-30650590 GCCCATCAGTAGGACTGGGAAGG - Intergenic
906720512 1:48001040-48001062 GCCCTTTAGCAGCACTGGGCTGG - Intergenic
906724566 1:48034775-48034797 GACCTTCTGGAGCACTCTGCTGG - Intergenic
908813879 1:68011891-68011913 GCCTTTCAGTGGCTTTGTGCAGG + Intergenic
913229477 1:116729862-116729884 GCCCCTCATTGGCACTGGGCTGG - Intergenic
920323620 1:205143968-205143990 GCGCTTCAGGAGGACTGTGCTGG - Exonic
921134980 1:212252013-212252035 GCCCTGCGGTAGTCCTGTGCAGG + Intergenic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1063899757 10:10720142-10720164 GCCCTTGACTACCACTGTGCAGG + Intergenic
1069490544 10:68856923-68856945 TCCTTTCAGTAGGTCTGTGCTGG + Intronic
1069750736 10:70743710-70743732 GCCCTCCAGTCTCCCTGTGCCGG - Intronic
1069833644 10:71295737-71295759 CCTCTTCTGTGGCACTGTGCGGG - Intronic
1083859284 11:65411404-65411426 GCCCCTCAGGAGGACAGTGCCGG - Exonic
1086489772 11:87347684-87347706 GGACTTCAGTGGTACTGTGCAGG - Intergenic
1088351301 11:108891342-108891364 GCCCTTCACAGGCGCTGTGCAGG + Intronic
1089688819 11:120173398-120173420 CCCTTTCAGAAGCACTGTGGGGG - Intronic
1089868562 11:121652602-121652624 GCCCTTCTGGAGGACTGTGAGGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1096636131 12:52960735-52960757 GGCCTTCAGTGGCAGGGTGCAGG - Intergenic
1100263524 12:92954506-92954528 GTCCTGTAGTAGCACTGGGCAGG + Intergenic
1104407494 12:128530268-128530290 GCCCTTCACCAGGGCTGTGCTGG + Intronic
1104446591 12:128838847-128838869 GCCCTCCAGAAGAGCTGTGCCGG - Intergenic
1108650591 13:52475092-52475114 GCCCTAATGCAGCACTGTGCCGG + Exonic
1109229877 13:59743640-59743662 ACCCTTCAGTAGATCTGTGAAGG - Intronic
1109729891 13:66398945-66398967 GGCCCTGAATAGCACTGTGCAGG + Intronic
1113825864 13:113252630-113252652 CCCCTTGCGTTGCACTGTGCAGG - Intronic
1113857592 13:113456535-113456557 GCCCCCCTGCAGCACTGTGCAGG - Intronic
1118336272 14:64855913-64855935 GCCTCTCAGTGGCACTGAGCAGG - Intronic
1118716018 14:68560750-68560772 GACCTTCAGAAGCACTGACCTGG + Intronic
1118904876 14:70016642-70016664 GCCCTTCAGGACAACTTTGCCGG + Intronic
1121622090 14:95357296-95357318 GCCCTTCTGTGGCCCAGTGCAGG + Intergenic
1121721804 14:96114585-96114607 CCCCTGAAGTAGGACTGTGCAGG + Intergenic
1122978157 14:105179477-105179499 ACCCTTCAGCAGAGCTGTGCCGG + Intronic
1124179962 15:27463773-27463795 GCAATTTAGAAGCACTGTGCAGG + Intronic
1124219350 15:27835767-27835789 GCACCTCAGTAACAGTGTGCTGG + Intronic
1125883971 15:43214749-43214771 GCCCTTCATTATAACAGTGCAGG - Intronic
1130101238 15:80895654-80895676 GCCATTCATTAGCTCTGGGCGGG - Intronic
1130654413 15:85782086-85782108 GCCCTCCAGTAGCAAAGTACAGG + Intronic
1136671143 16:31859534-31859556 GCCCTCTAGTGGCCCTGTGCAGG - Intergenic
1139380029 16:66524740-66524762 CCACTTCAGTAGCACTGAGGTGG - Intronic
1139698506 16:68692471-68692493 CCCTTTCAGAACCACTGTGCGGG - Intronic
1141509223 16:84501770-84501792 TCCCTTCACCAGCACTCTGCAGG - Intronic
1151674559 17:75590820-75590842 GCCCCTCAGTCCCACTCTGCAGG - Intergenic
1152263956 17:79282647-79282669 GCCCATAAGAGGCACTGTGCAGG + Intronic
1153323598 18:3796121-3796143 GCCCTTCTGTATCTCTGTTCTGG + Intronic
1153964042 18:10164943-10164965 GTCCTTCAGTAGCTCTGTAAGGG + Intergenic
1154217023 18:12422953-12422975 CCCCATCCCTAGCACTGTGCTGG - Intronic
1157185557 18:45537474-45537496 GCCCTAAAGTGGCAGTGTGCTGG + Intronic
1158486216 18:57868353-57868375 TCTCTTCAGAAGCAGTGTGCAGG - Intergenic
1160447992 18:78942069-78942091 GCCCTTCAGTGGAACTCTGCTGG - Intergenic
1161478194 19:4497899-4497921 GCCCCTCAGTGGCAGAGTGCCGG + Intronic
1163263016 19:16202623-16202645 GCGCATCAGAATCACTGTGCTGG - Intronic
1163813625 19:19450261-19450283 GCCATTCAGCAGCACAGTGCTGG + Intronic
1164794541 19:31015380-31015402 GCCCATCATGAGCACTGGGCGGG + Intergenic
925300076 2:2805483-2805505 GCCCTGCAGCAGCACTCAGCGGG + Intergenic
933722968 2:85409966-85409988 GGCCTTCAGGAGCAGTGTGGTGG + Intronic
933998327 2:87686180-87686202 GCCCTTGAGCAGGACTTTGCAGG - Intergenic
936295521 2:111264693-111264715 GCCCTTGAGCAGGACTTTGCAGG + Intergenic
940041635 2:149367691-149367713 GCCCTGGGCTAGCACTGTGCAGG + Intronic
942786799 2:179709854-179709876 TGCCTGCAGTAGCTCTGTGCAGG - Intronic
947081035 2:226397353-226397375 GCCCTCCAGTGGCACTTTGAAGG - Intergenic
947335795 2:229081508-229081530 GCCCTTCAGTGGCTCTCTGCTGG - Intronic
1171391073 20:24802111-24802133 GCCCTGCAGCAGCACTGTGTGGG - Intergenic
1180390756 22:12280031-12280053 GCCCTGCAGAAGCCCTGCGCTGG - Intergenic
1183091754 22:35527023-35527045 GCCCTTGGGGAGCACTGTGGAGG - Intergenic
1183656245 22:39186597-39186619 TCCCTTCAGTAGCAATGTTCTGG - Intergenic
1184914903 22:47562711-47562733 GCTTCTCAGTCGCACTGTGCAGG - Intergenic
950009534 3:9713032-9713054 GCCCTTCAGCATCCCTGTGCGGG + Exonic
954539110 3:51382114-51382136 GCCCCTCAGTAGCACACTCCTGG - Exonic
954821110 3:53328209-53328231 GCCCTTCAGGTTCAGTGTGCTGG - Intronic
964457845 3:156887312-156887334 GCCCTTGAGGTGCACAGTGCAGG + Intronic
968644064 4:1729920-1729942 GCCCTCCAGTGGCCCTGTCCGGG + Intronic
970865040 4:20748385-20748407 GTCCATCAGTTGCACTGAGCAGG + Intronic
973294901 4:48507666-48507688 GCCCTACAGTTTCACTGGGCTGG + Intronic
982726495 4:158911617-158911639 GACCTTGAGTAGCAAGGTGCTGG - Intronic
983759158 4:171384262-171384284 GCCCTGCAGCAGCACTCAGCAGG - Intergenic
985160563 4:187040126-187040148 GAGCTTAAGAAGCACTGTGCTGG - Intergenic
985929847 5:3048379-3048401 GACCCTCAGGAGCACTGTGTGGG + Intergenic
986737625 5:10679891-10679913 GCCCTCCACAAGCACTGTTCTGG + Exonic
987000665 5:13656111-13656133 GCCCTCCAGTGGGAGTGTGCAGG + Intergenic
987309159 5:16666345-16666367 TCCCTTCAGTAGCACAGTTACGG + Exonic
995773664 5:115700738-115700760 GCCCTGAAGTAGCTCTCTGCTGG - Intergenic
995978441 5:118071911-118071933 GCCCTTCAGAAGTTCTTTGCAGG - Intergenic
996271280 5:121607491-121607513 GCCACTCAGTAGCCCTATGCAGG + Intergenic
999434043 5:151549353-151549375 GACCTGCAGCAGCTCTGTGCCGG + Exonic
1005212861 6:23488703-23488725 GGCCTTCTGGAGCACAGTGCTGG + Intergenic
1011002513 6:82606890-82606912 GCCCTGCTGCAGCACTGTGATGG + Intergenic
1018358050 6:163038439-163038461 GCCCTTCACTGGCTGTGTGCAGG - Intronic
1020221138 7:6238570-6238592 GCCCTTCAGTGAAACTGTTCTGG + Intronic
1020352554 7:7236989-7237011 GACTTTCAGTAGCAATGTTCTGG - Intronic
1020395651 7:7714330-7714352 ACACTTCAGCAGCACTCTGCTGG - Intronic
1031235412 7:119169148-119169170 GGGCTACAGTAGCACAGTGCTGG - Intergenic
1036533110 8:9615573-9615595 GTGCTGCAGCAGCACTGTGCAGG - Exonic
1037739675 8:21598352-21598374 GCCCTAGACTAGGACTGTGCTGG + Intergenic
1042803360 8:72745042-72745064 GAGCTGCAGTAGCAGTGTGCTGG - Intronic
1044302218 8:90597684-90597706 GCCCTTGAGTAGCACTGAAGTGG - Intergenic
1045320840 8:101080508-101080530 GCCCATCACTTGCACTGTACTGG - Intergenic
1046643019 8:116753729-116753751 GCACTTCAGTAACAATGTCCTGG - Intronic
1048030753 8:130629429-130629451 GCCCTTCTGCATGACTGTGCTGG + Intergenic
1050478478 9:6065084-6065106 GCACTTCAGCAGCACTGGCCAGG + Intergenic
1051004747 9:12329565-12329587 GCCCTCTAGTGGCCCTGTGCGGG + Intergenic
1051258837 9:15242149-15242171 GATCTTCAATACCACTGTGCTGG + Intronic
1051602574 9:18889823-18889845 GCCCTTCAGTAGCACTGTGCAGG + Intronic
1052273743 9:26655287-26655309 GCCCTTCAGGAGAACTGTGTAGG + Intergenic
1058081375 9:100704099-100704121 GCCATTCAGGAGTACTGGGCAGG - Intergenic
1061629903 9:131865718-131865740 GCCTTTCAGCAGCCATGTGCAGG + Intronic
1189376665 X:40471976-40471998 ACAGTTCAGTGGCACTGTGCAGG - Intergenic
1191716682 X:64198524-64198546 GCCATTCTGCTGCACTGTGCAGG + Intronic
1191959150 X:66680345-66680367 GCCCTTCAGGAGCACTGGGCTGG - Intergenic
1198428984 X:136547028-136547050 GCACTCCAGTAACACTGGGCAGG + Intronic
1202337794 Y:23828927-23828949 TCCCTCCTGTAGCACTGTACAGG - Intergenic
1202532972 Y:25841144-25841166 TCCCTCCTGTAGCACTGTACAGG + Intergenic