ID: 1051602762

View in Genome Browser
Species Human (GRCh38)
Location 9:18891157-18891179
Sequence AAGCCAGATGTGGCGCCGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051602755_1051602762 4 Left 1051602755 9:18891130-18891152 CCCTTCCCTGCTACATGCCTCTC 0: 1
1: 0
2: 1
3: 44
4: 412
Right 1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG No data
1051602754_1051602762 5 Left 1051602754 9:18891129-18891151 CCCCTTCCCTGCTACATGCCTCT 0: 1
1: 0
2: 1
3: 51
4: 457
Right 1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG No data
1051602753_1051602762 27 Left 1051602753 9:18891107-18891129 CCAGATTTAGGAGGAATTTGCTC 0: 1
1: 0
2: 0
3: 10
4: 117
Right 1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG No data
1051602757_1051602762 -1 Left 1051602757 9:18891135-18891157 CCCTGCTACATGCCTCTCCTGAA 0: 1
1: 0
2: 1
3: 16
4: 168
Right 1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG No data
1051602758_1051602762 -2 Left 1051602758 9:18891136-18891158 CCTGCTACATGCCTCTCCTGAAA 0: 1
1: 0
2: 1
3: 13
4: 171
Right 1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG No data
1051602756_1051602762 3 Left 1051602756 9:18891131-18891153 CCTTCCCTGCTACATGCCTCTCC 0: 1
1: 0
2: 2
3: 42
4: 502
Right 1051602762 9:18891157-18891179 AAGCCAGATGTGGCGCCGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051602762 Original CRISPR AAGCCAGATGTGGCGCCGCT TGG Intronic
No off target data available for this crispr