ID: 1051603472

View in Genome Browser
Species Human (GRCh38)
Location 9:18897191-18897213
Sequence GACATCTGTTAGTATAACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 86}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051603472_1051603483 14 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603483 9:18897228-18897250 GACAGAGCCCCCGGGGGAAGGGG No data
1051603472_1051603477 7 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603477 9:18897221-18897243 TCCCTGGGACAGAGCCCCCGGGG No data
1051603472_1051603481 12 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603481 9:18897226-18897248 GGGACAGAGCCCCCGGGGGAAGG No data
1051603472_1051603476 6 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603476 9:18897220-18897242 CTCCCTGGGACAGAGCCCCCGGG No data
1051603472_1051603475 5 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603475 9:18897219-18897241 TCTCCCTGGGACAGAGCCCCCGG 0: 14
1: 606
2: 734
3: 497
4: 593
1051603472_1051603479 8 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603479 9:18897222-18897244 CCCTGGGACAGAGCCCCCGGGGG No data
1051603472_1051603474 -8 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603474 9:18897206-18897228 CAGATGTCTGATCTCTCCCTGGG No data
1051603472_1051603473 -9 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603473 9:18897205-18897227 ACAGATGTCTGATCTCTCCCTGG No data
1051603472_1051603482 13 Left 1051603472 9:18897191-18897213 CCTGGGTTATACTAACAGATGTC 0: 1
1: 0
2: 1
3: 11
4: 86
Right 1051603482 9:18897227-18897249 GGACAGAGCCCCCGGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051603472 Original CRISPR GACATCTGTTAGTATAACCC AGG (reversed) Intronic
905197948 1:36295737-36295759 GAAATTTGTCAGTATAACTCAGG + Intronic
906873387 1:49509465-49509487 GACACATGTTTTTATAACCCAGG - Intronic
912218967 1:107650318-107650340 GACATCAGTAAGTATATGCCAGG - Intronic
912474464 1:109926872-109926894 GCCCTCTCTTAGTAGAACCCAGG - Intronic
913435871 1:118846928-118846950 GATATCTGTTGAAATAACCCAGG - Intergenic
918426487 1:184415403-184415425 ATTATCTGTTAGTAAAACCCAGG - Intronic
922396237 1:225203654-225203676 GACATGTATTAGAATAACTCAGG + Intronic
924954473 1:248913514-248913536 GGCATCTATTAGTAGAAGCCAGG + Intronic
1067994872 10:51260654-51260676 GATTTCTGATGGTATAACCCTGG - Intronic
1072657085 10:97337315-97337337 GACCTCTGTTAGTAAACCGCTGG - Intergenic
1083490243 11:63010311-63010333 GACACCTGTTAGTAGAAGCAAGG - Intronic
1085150719 11:74251048-74251070 GACAACTGTGAGAATAACCCTGG + Intronic
1086725659 11:90180207-90180229 GACATGTGTTACTAAATCCCAGG + Intronic
1086820718 11:91433272-91433294 GAGTTCTGTCAATATAACCCTGG + Intergenic
1093975267 12:25414403-25414425 GGCATTGGTTAGTCTAACCCAGG - Intronic
1096763806 12:53866446-53866468 GCCATCAGTTAGCATAACCCAGG - Intergenic
1099232246 12:80040230-80040252 GTAATCCGCTAGTATAACCCAGG - Intergenic
1102825619 12:115945688-115945710 GACATCTGGCAGTGAAACCCTGG - Intergenic
1107858810 13:44641702-44641724 CACATCTTTTATAATAACCCAGG - Intergenic
1108352017 13:49596466-49596488 GACATCTGTTAGTACCAGCTTGG + Intergenic
1108550681 13:51540755-51540777 GGCAGCTGTTATTATAACCATGG - Intergenic
1109779228 13:67085242-67085264 GAGATCTGTGAATATAGCCCTGG + Intronic
1112192828 13:97194474-97194496 AACATCTCTTTGTATAATCCTGG + Intergenic
1112399454 13:99063232-99063254 GACATCTTTCAGTATGACCCAGG - Intronic
1120427385 14:84365550-84365572 GACATCTTTAAATATAACTCAGG + Intergenic
1122170091 14:99865915-99865937 AACAAATGTTAGTATAACCTGGG + Intronic
1124923519 15:34048520-34048542 GAGCTCTGTCTGTATAACCCTGG - Intronic
1126956257 15:53936345-53936367 GAGATCTGTTTGTATAACCCTGG - Intergenic
1127012195 15:54642836-54642858 GAGCTCTGTCTGTATAACCCTGG - Intergenic
1129864156 15:78890423-78890445 AACATATATTAATATAACCCTGG + Intronic
1138911362 16:61403410-61403432 GACATGGGTTAGTATTAGCCTGG + Intergenic
1141554991 16:84831194-84831216 GACATCTGACAGGATAACCTCGG + Intronic
1148136957 17:45299542-45299564 GACATCTGTTTCTATGTCCCAGG - Intronic
1149001335 17:51760689-51760711 CACATCTGATGGTATAACCTGGG + Intronic
1150720976 17:67614148-67614170 GACAGATGTTAGTATCACCAAGG - Intronic
1153249952 18:3111475-3111497 GACCACTGTTAGTTTAGCCCAGG + Intronic
1158887484 18:61842019-61842041 GATACCTTTTAGTATAGCCCTGG - Intronic
1164256226 19:23530580-23530602 CACTTCTGTTAGCATGACCCAGG + Intronic
1166588204 19:43969732-43969754 GATTTCTGTCAGTATAAGCCTGG - Intronic
928883382 2:36122385-36122407 GAGTTCTGTCTGTATAACCCTGG + Intergenic
933565031 2:83939877-83939899 GACATCTTTTAGCATGTCCCAGG + Intergenic
934548699 2:95240971-95240993 GAGCTCTGTTCGTATAACCCTGG - Intronic
937780982 2:125837141-125837163 GACATCTGGTGGTACAACCTGGG - Intergenic
1178431845 21:32524586-32524608 GACCTCTGATTGTAAAACCCTGG + Intergenic
1181433844 22:22899051-22899073 CACATCTGTTAGGGTAACCTTGG - Intergenic
1181434782 22:22904421-22904443 CACATCTGTTAGGGTAACCTTGG - Intergenic
955504938 3:59622759-59622781 GTCATCTCTTAGTATACCCAGGG + Intergenic
955881302 3:63549102-63549124 GGCAAATGTTAGAATAACCCAGG + Intronic
958760702 3:98304607-98304629 GACTTCTGTTAGTAAAAACTAGG + Intergenic
958873146 3:99584909-99584931 CACAACTGTTAGTATAACTTAGG - Intergenic
960050574 3:113235276-113235298 GACTTATGTGGGTATAACCCTGG + Intronic
962428689 3:135298938-135298960 GACCTCTGTTCATATCACCCTGG + Intergenic
963131207 3:141859949-141859971 GACACCAGTTACTATAAACCTGG + Intergenic
970475463 4:16417640-16417662 GCCATATTTTAGTATAACACAGG - Intergenic
970665352 4:18330270-18330292 GAAATCTATTATTATATCCCTGG - Intergenic
973284801 4:48403373-48403395 GAGTTCTGTTCGTATAACCCTGG + Intronic
975998287 4:80341158-80341180 GAGTTCTGTCTGTATAACCCTGG - Intronic
976810260 4:89092595-89092617 AACATCTGCTACTATAACACAGG - Intronic
979540297 4:121873047-121873069 TCCATCTGTTAGTATCACCATGG + Intergenic
985290551 4:188382137-188382159 GACAGCTGTTTGCAAAACCCAGG + Intergenic
987737066 5:21859893-21859915 GGCATCTCTTAGTATTACCATGG + Intronic
987919788 5:24264620-24264642 GAGATCTGTTGCTATAACCCTGG - Intergenic
987923087 5:24308772-24308794 AGCATCTATTAGTAAAACCCTGG + Intergenic
989814127 5:45714750-45714772 GACATCTTTAAATTTAACCCTGG - Intergenic
990833699 5:59990311-59990333 GGCAGCTGTTATTATAATCCAGG + Intronic
993029784 5:82692895-82692917 GAAATTTGTGAGTAAAACCCTGG + Intergenic
993375916 5:87149429-87149451 GAGTTCTGTTTGTATAACTCTGG + Intergenic
995532986 5:113109263-113109285 TTCATCTGTCAGTATACCCCTGG - Intronic
996054618 5:118969135-118969157 GAGATCTGTTCATATAACTCAGG - Intronic
996279205 5:121707259-121707281 AAAATCTGTCAGTATTACCCTGG - Intergenic
1001398932 5:171435370-171435392 GATATGTGTTGGTATAACCAGGG + Intronic
1007040323 6:38715542-38715564 CACCTCTGTTAGTTGAACCCAGG + Intronic
1012142656 6:95643017-95643039 GAGCTCTGTTCATATAACCCTGG - Intergenic
1013425625 6:110010117-110010139 GAGCTCTGTTAATAAAACCCAGG + Intergenic
1017419845 6:154262388-154262410 TACATCTACAAGTATAACCCTGG - Intronic
1023927680 7:44681949-44681971 TACATCTGTTATTAAAAACCAGG + Intronic
1026736594 7:72952937-72952959 GACATCTGTTAGATTAAACTGGG + Intergenic
1027107140 7:75412126-75412148 GACATCTGTTAGATTAAACTGGG - Intergenic
1033822791 7:145154032-145154054 GAGATCTGTTACTAAAATCCAGG + Intergenic
1035978375 8:4339193-4339215 GAGATCTGCAAGTATACCCCAGG + Intronic
1037025664 8:14033598-14033620 GACATTTGTTAGTATAGCCAGGG + Intergenic
1038170304 8:25125710-25125732 GACATCTGCTGCTACAACCCTGG + Intergenic
1041758808 8:61341756-61341778 CCAATCTGTTAGTACAACCCTGG - Intronic
1041992323 8:64008361-64008383 GACATCTGTTAGTTTAACGTGGG + Intergenic
1042773398 8:72403365-72403387 GACATATGTATGTATACCCCTGG + Intergenic
1046986882 8:120397962-120397984 GAGATCTGTCTGTATAACCCTGG - Intronic
1048720201 8:137314870-137314892 GACAACATTTTGTATAACCCCGG - Intergenic
1048896422 8:138996502-138996524 GACACCTGCTAGCAGAACCCAGG - Intergenic
1051603472 9:18897191-18897213 GACATCTGTTAGTATAACCCAGG - Intronic
1055968937 9:81892324-81892346 TACATCTTTAACTATAACCCCGG + Intergenic
1061311718 9:129767934-129767956 GCCATCTCTTAGTATCACCATGG - Intergenic
1188522448 X:31053798-31053820 GTCATCTAACAGTATAACCCAGG - Intergenic
1188831458 X:34902924-34902946 GGCCACTGTTATTATAACCCAGG + Intergenic
1191065512 X:56343269-56343291 GAGTTCTGTTCATATAACCCGGG + Intergenic
1191701568 X:64047890-64047912 GAAATCTGTCTGTATAACCCTGG - Intergenic
1191815587 X:65241223-65241245 AAGTTCTGTTTGTATAACCCTGG + Intergenic
1191815639 X:65241483-65241505 GAGTTCTGTTTGTATAATCCTGG + Intergenic
1194263980 X:91733474-91733496 GAGTTCTGTTTGTAAAACCCTGG + Intergenic
1197533206 X:127656330-127656352 TACATCTGTTACTAAAACCCAGG + Intergenic