ID: 1051604230

View in Genome Browser
Species Human (GRCh38)
Location 9:18905014-18905036
Sequence GGTTCCACTGGGGGTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 345
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051604230 Original CRISPR GGTTCCACTGGGGGTGGTGC TGG (reversed) Intronic
900176913 1:1295075-1295097 GGGCCCACTGCGGGGGGTGCCGG - Intronic
900371737 1:2335310-2335332 GCTTCCGCCGGGGGTGGGGCGGG - Intronic
900415393 1:2532312-2532334 GGTTGGACTGGGGGTGGGGAGGG + Intergenic
900957979 1:5899481-5899503 GGTTCCCTTGGGGGAGGTGAAGG + Intronic
901068665 1:6506588-6506610 GGTTCCACTGGGGCTGGGAGCGG - Intronic
901079223 1:6574465-6574487 GGCTCCACTGGGGCAGGTTCTGG - Intronic
901764777 1:11492740-11492762 GGTTTCCCTGGGGCTGGGGCAGG + Intronic
901893306 1:12286757-12286779 GGTTCAAGTGGTGGTGGTGGTGG + Intronic
902403146 1:16168787-16168809 GGTGCCACCGGGCGTGGTGGTGG - Intergenic
904039104 1:27574206-27574228 CCTTCCACTGGGGGTGGGGCGGG - Intronic
904399749 1:30248296-30248318 GGAACCACTGGGGGTGCTACAGG - Intergenic
905089624 1:35418486-35418508 GGTTCCAGTGGGGGTGGAGATGG + Exonic
906198536 1:43945005-43945027 GGTTTCACTGGTGGAGGTGGTGG - Intergenic
906239668 1:44235090-44235112 GGAGCCACTGGAAGTGGTGCTGG - Intronic
906703985 1:47881169-47881191 GGTTGCAGTGGTGGTGGTGGTGG + Intronic
906825143 1:48971366-48971388 TTTTCCACTGGGGGTGGAGGGGG - Intronic
906851163 1:49251559-49251581 GGTTGCATTGGAGGTGGTGTTGG - Intronic
907349198 1:53811860-53811882 TGTTCCAGTGGAGGTGGTGAGGG - Intronic
907413254 1:54297128-54297150 GTTCCCACTGGAGGTGGTGGTGG - Intronic
910598465 1:89005246-89005268 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
911046831 1:93635682-93635704 GGTCCCACAGGGGATGGCGCTGG + Intronic
911310671 1:96288867-96288889 AGTTGCACTGGAGGTGGTGTTGG + Intergenic
913256738 1:116960826-116960848 TGTTCCAGTGGGGGTGTTGGAGG + Intronic
913972997 1:143430277-143430299 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
914067381 1:144255884-144255906 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
914111772 1:144710470-144710492 TGTTCCAGTGGAGGTGGTGAAGG - Intergenic
915288751 1:154869206-154869228 GGTGCTGCTGGCGGTGGTGCCGG + Exonic
916695527 1:167232046-167232068 GGTTCCACAGGGCCTGCTGCAGG - Intronic
918380093 1:183945221-183945243 GGTGCCACTTGGGGTGGTGACGG - Intronic
919207660 1:194437739-194437761 GGTTGCACTGGAGGTGGGGTTGG - Intergenic
919765196 1:201122660-201122682 GGATCTCCTGGGGGTGGAGCTGG + Intronic
919902544 1:202054962-202054984 GCTTACACTGGGGCTGGTGAGGG + Intergenic
920041290 1:203099313-203099335 TGTGCCACTGGGGGTGGGGTAGG - Intronic
920506373 1:206518185-206518207 TTTTCCACTGGGGGAGGTGGAGG + Intronic
920560062 1:206932510-206932532 GGTGCCCCTGGGCCTGGTGCTGG - Exonic
922673341 1:227532085-227532107 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
923012027 1:230095720-230095742 TGTGACACTGGGCGTGGTGCAGG + Intronic
923492169 1:234493718-234493740 GTTTCCCCTGGGGGTGGAGGAGG - Intergenic
1062760856 10:17536-17558 TGTTCCAGTGGAGGTGGTGAAGG - Intergenic
1064710207 10:18115429-18115451 GGTTTCTCTGGTGGTGGTGGTGG - Intergenic
1065484196 10:26221468-26221490 GGTGCTAGTGGTGGTGGTGCTGG + Intronic
1067112189 10:43408643-43408665 GGTCCCCCTGGGGGTGGGGACGG - Intronic
1071431667 10:85611637-85611659 GGTTCTACTGGGGGTGGCTTTGG + Intronic
1071676336 10:87659571-87659593 GGACCCTCTGGGGGTGGGGCGGG + Intergenic
1071944903 10:90633392-90633414 GTTTCTACTGGTGGTGGTACAGG - Intergenic
1072551271 10:96479499-96479521 GATTGCAGTGGGGATGGTGCTGG - Intronic
1073453333 10:103622269-103622291 GGTGGCACTGGGGGTGGCTCTGG - Intronic
1074868588 10:117559699-117559721 GGTCCCACTGGTGGTCATGCAGG + Intergenic
1075539399 10:123299646-123299668 GGCTTCACTAGGAGTGGTGCAGG + Intergenic
1075616539 10:123893894-123893916 GGTTCTGATGGAGGTGGTGCAGG - Intronic
1076326664 10:129628970-129628992 GGTTCCCCCGGGAGTGGCGCTGG - Intronic
1077210222 11:1367683-1367705 GGTTCCACAGGTGGTGTTTCCGG - Intergenic
1077437526 11:2549960-2549982 GGGTCTACTGGAGGTGGAGCTGG - Intronic
1078408864 11:11095084-11095106 GCTTCCATTGGGTGTGGTGCTGG - Intergenic
1080669078 11:34359166-34359188 GGTTCCACTGGAGGGGGCACAGG - Intergenic
1081600370 11:44488536-44488558 GGTGCCACTGGGGCTGGTGCTGG - Intergenic
1081652127 11:44831460-44831482 GGTTCCCCTGGGGCTTGTGAGGG - Intronic
1083281370 11:61629121-61629143 GGGTCCTCTGGGGCTGGGGCTGG - Intergenic
1083880634 11:65546719-65546741 GGCTCCGCTGGGGGCGGGGCGGG - Intronic
1084304584 11:68273228-68273250 GGTTGAACTGGGGATGGTGGTGG - Intergenic
1084858576 11:72003971-72003993 GGTTCCACTGCGAGTGTTGGGGG + Exonic
1087309239 11:96521180-96521202 GGTTGCACTGGAGGTGGTGCTGG + Intergenic
1087597673 11:100273606-100273628 GCTTGCACTGGAGGTGGTGTTGG - Intronic
1088367339 11:109053362-109053384 TGTTCCACAGGGGGTCCTGCAGG - Intergenic
1089786029 11:120907872-120907894 TGTGCCACTGGGGTTGGTCCTGG + Intronic
1090076450 11:123582663-123582685 GGTTTCACTGTGGGGGGTGAAGG + Intronic
1090413240 11:126523320-126523342 GGTTCTTCTGGAGGTGGGGCAGG + Intronic
1090728989 11:129553540-129553562 GGTTCCACTGTGGGGAGGGCAGG + Intergenic
1091583096 12:1800505-1800527 GGTCTCTCTGAGGGTGGTGCTGG - Intronic
1092260500 12:6951222-6951244 GGTGGCACTGGGGGTGGGGACGG - Intronic
1098678627 12:73321930-73321952 GGTTGCACTGGAGGTGGTGTAGG - Intergenic
1099622108 12:85016286-85016308 GCCTCCACTGGGGGTATTGCTGG - Intronic
1100135284 12:91545835-91545857 TGTTGCACTGGAGGTGGTGATGG - Intergenic
1100809591 12:98325142-98325164 GGTGCCACTGGTGGTGGAGAGGG + Intergenic
1105396717 13:20043494-20043516 GGTTGCACTGGTGGTGGTGGTGG + Intronic
1106566906 13:30893593-30893615 GGAGCCATTGGGGGTGGTGTAGG - Intergenic
1108817149 13:54305657-54305679 TGTTCCAGTGGAGGTGGTGGGGG - Intergenic
1108923039 13:55700335-55700357 GGTTCCTCTGGGGATGATGATGG - Intergenic
1109136125 13:58653719-58653741 AGTGCCACTGGTGCTGGTGCTGG - Intergenic
1113231706 13:108218804-108218826 GCTTCCCCTGGGGGTCGTGCGGG + Intronic
1113619116 13:111701107-111701129 GGTTCCACTAGAGGAGGTGGAGG + Intergenic
1113624645 13:111786368-111786390 GGTTCCACTAGAGGAGGTGGAGG + Intergenic
1113848917 13:113407096-113407118 GGTCCCAGTGGGGATGATGCAGG + Intergenic
1115546162 14:34466533-34466555 GGTGGGACTGGGGGTGGGGCGGG - Intergenic
1116990838 14:51274711-51274733 GGTTCCACTGAGGGAGTTGCTGG + Intergenic
1117391409 14:55266339-55266361 GGAGGCACTGGGGGTGGTGGGGG - Intergenic
1118540160 14:66814295-66814317 TGTTGCACTGGAGGTGGTGTTGG - Intronic
1118812562 14:69285947-69285969 GGTTGCACTGGGGCGGGTGGGGG - Intronic
1122075063 14:99230596-99230618 GGTTCCACTTGGGGAGAAGCAGG + Intronic
1122155988 14:99750787-99750809 GGTTAGACTCGGGGTGGTGGAGG - Intronic
1122632370 14:103112793-103112815 GGTGCCGGTGGGGGTGGGGCTGG + Intergenic
1122646136 14:103195485-103195507 AGTTCCACTGGGGGTGTTTCTGG + Intergenic
1124380771 15:29162913-29162935 TGTTCCAGTGGAGGTGGTGGGGG - Intronic
1126416248 15:48420696-48420718 GGTTCCACTGGTAGTGCTGGAGG + Exonic
1127047559 15:55043187-55043209 GGTACCAGTGGTGGTGGTGGTGG + Intergenic
1127613212 15:60657333-60657355 GCTTCCCCAGGGGGTGGGGCAGG - Intronic
1129710235 15:77817126-77817148 GTTACCACTGGGGGTGGGGCTGG - Intronic
1129787657 15:78320280-78320302 TCTTCCACTGGGGATGGGGCGGG - Intergenic
1129894188 15:79091414-79091436 GGGTGCACGGGGGGTGGCGCCGG - Intergenic
1131172926 15:90191196-90191218 GGCCCCAGTGGGGGTGGTGCTGG + Intronic
1135066780 16:19316891-19316913 GGTTCTAGAGGGGGTGGGGCAGG - Intronic
1137585144 16:49659812-49659834 GGCACCCCTGTGGGTGGTGCTGG + Intronic
1138096409 16:54215285-54215307 GGTTTGCCTGGGGATGGTGCTGG + Intergenic
1138228845 16:55323684-55323706 CGCTCCGCTGGGGGTGGCGCTGG - Intergenic
1139311104 16:66028903-66028925 GATTCCACTGGGCTTGGTGATGG + Intergenic
1141311802 16:82920621-82920643 GGCCCCACTGTGGATGGTGCTGG + Intronic
1141444250 16:84047862-84047884 GGAAACACTGGGGGTGCTGCGGG + Intergenic
1142046753 16:87930464-87930486 GGTTCCACTGGGGAAGGGTCCGG - Intronic
1143619619 17:8073451-8073473 GGTTAGACTGGGGGTGGGGCTGG + Intronic
1144139625 17:12336271-12336293 TGTTCCAGTGGAGGTGGTGGGGG + Intergenic
1144746969 17:17622326-17622348 GTTTCCTTTGGGGGTGGTTCTGG - Intergenic
1144855255 17:18263990-18264012 GGTGCCACTGGTGCTGGAGCCGG + Exonic
1144872357 17:18379112-18379134 TTTTCCAGTGGGTGTGGTGCAGG + Intronic
1144873565 17:18384764-18384786 TTTTCCAGTGGGTGTGGTGCAGG + Intronic
1145257005 17:21330983-21331005 GTCTCCACTGCGGTTGGTGCAGG - Intergenic
1145319628 17:21757071-21757093 GTCTCCACTGCGGTTGGTGCAGG + Intergenic
1145971638 17:28959719-28959741 CATTCCACTGGGGGTCGTGGGGG + Exonic
1146179683 17:30689602-30689624 GGTTGCAATCAGGGTGGTGCAGG + Intergenic
1146300462 17:31685357-31685379 GGGTCCAGTGTGGGTAGTGCCGG - Intergenic
1146576826 17:34001444-34001466 GGGTCCAGTGGGGCTGGTGCTGG + Intronic
1146627473 17:34445369-34445391 GGCTCCAGTGGGGGTGGGGACGG - Intergenic
1147412663 17:40264849-40264871 GGTTTGACTGGGGGTGGAGCAGG - Exonic
1148083550 17:44980642-44980664 GCTCCAGCTGGGGGTGGTGCTGG - Intergenic
1148103939 17:45109360-45109382 GGCTCCTCTGGTGGAGGTGCAGG + Exonic
1148740467 17:49889887-49889909 GGTTCCAGTGGGGGTGGGGCAGG + Intergenic
1148849853 17:50549270-50549292 GTTTCCACTGCGGGAGGTGGGGG - Exonic
1149410856 17:56405047-56405069 TGTTCCAGTGGAGGTGGTGGTGG + Intronic
1149868256 17:60162351-60162373 GGGTCTGCTGGGGGTGGTGGAGG - Intronic
1150600130 17:66643818-66643840 AGTTCCACTTGGGATGGGGCAGG + Intronic
1151748906 17:76025910-76025932 TTTTCCAGTGGGTGTGGTGCAGG - Intronic
1151833434 17:76569066-76569088 AGTTAAACTGGGGGTGGTGGGGG + Intronic
1152953763 18:17890-17912 TGTTCCAGTGGAGGTGGTGAAGG - Intergenic
1154170718 18:12048217-12048239 GGTTACACTGCCGGTGGTGTGGG - Intergenic
1154454541 18:14509239-14509261 TGTTGCACTGGAGGTAGTGCTGG + Intronic
1159878411 18:73834946-73834968 CCTTCCACTGGTGGTGGTGCCGG - Intergenic
1160569001 18:79803875-79803897 GGTTTCTCCGGGGTTGGTGCCGG + Intergenic
1160976834 19:1796873-1796895 GGTTCTCCTGGGGGTGGCGGGGG + Exonic
1161257098 19:3315460-3315482 GCTTCCAGTGGTGGTGGTGGGGG + Intergenic
1161587779 19:5114770-5114792 GGTCCCACTCTGGGTGCTGCAGG + Intronic
1162021176 19:7869314-7869336 GCTGCCACTGGGGGCGCTGCAGG - Exonic
1162706794 19:12561025-12561047 GTGAGCACTGGGGGTGGTGCCGG + Intronic
1162841508 19:13359729-13359751 GGTCCCATTGGGGCAGGTGCGGG + Exonic
1162938436 19:13993731-13993753 GGTGCCGCTGGGGGTGGTGGCGG + Exonic
1162978927 19:14225960-14225982 GGTTGCAATCAGGGTGGTGCAGG - Intergenic
1163262951 19:16202152-16202174 GGCGAGACTGGGGGTGGTGCGGG - Intronic
1163313021 19:16525374-16525396 GGTTGAACTGCGGGTGCTGCTGG + Exonic
1163610926 19:18301199-18301221 GGTTCCAGTGGAGGCGGGGCAGG + Intergenic
1163819429 19:19487590-19487612 GGTTCCACTCGGGGGAGTGCAGG - Intronic
1164320126 19:24137140-24137162 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
1165248761 19:34513532-34513554 GGGGACACTGGGGGTGGTGGTGG + Intergenic
1165273895 19:34732514-34732536 GGGGACACTGGGGGTGGTGGTGG - Intergenic
1165420674 19:35720638-35720660 GGGGACACTGGGGGTGGTGGTGG - Exonic
1166051764 19:40264808-40264830 CATTCCAGTGGGGGTGGGGCAGG - Intronic
1166232480 19:41433264-41433286 GGTCTCACTGGAGGTGGTGGAGG + Exonic
1166272260 19:41721690-41721712 GGCTCCACTTGGGGTGGGACCGG + Intronic
1166381396 19:42357055-42357077 GTTTCCTCTGGGGATGGAGCTGG - Intronic
1166604205 19:44126427-44126449 TGTTCCAGTGGAGGTGGTGGGGG + Intronic
1167837273 19:52084566-52084588 GGCTCCACTGGGCATGGTCCTGG - Intronic
1167846332 19:52167840-52167862 GGCTCCACTGGGCATGGTCCTGG - Intronic
1167878201 19:52431685-52431707 GGTTCCACTGGGCATGGTCCTGG + Intronic
1167886224 19:52502131-52502153 GGCTCCACTGGGCATGGTCCTGG + Intronic
1167912509 19:52715613-52715635 GGCTCCACTGGGCATGGTCCTGG - Intronic
1167922215 19:52791278-52791300 GGCTCCACTGGGCATGGTCCTGG - Intronic
1167927481 19:52833328-52833350 GGTTCCACTGGGCATGGTCCTGG - Intronic
1167932032 19:52873773-52873795 GGCTCCACTGGGCATGGTCCTGG - Intronic
1167942064 19:52955809-52955831 GGCTCCACTGGGCATGGTCCTGG - Intronic
1168327323 19:55544988-55545010 GGGTCCACTGAGAGTGGTGGGGG + Intronic
925025401 2:603149-603171 GGGTGCACTGGGGGTGGCTCTGG - Intergenic
925912054 2:8580523-8580545 GTGTGCACTGGGGGTGGTGCTGG - Intergenic
925914912 2:8597935-8597957 GGATCCCATGGGGGTGGCGCAGG + Intergenic
927058914 2:19395169-19395191 GTTTCCACTGGGTGAGCTGCAGG + Intergenic
927862957 2:26571404-26571426 GGTCCCACTTGGGTTGGAGCTGG + Intronic
928167227 2:28980179-28980201 GGTCCCTCTGGGGCAGGTGCTGG - Intronic
928474102 2:31606906-31606928 GGTTCCTCTGAGGGTTGTGATGG + Intergenic
933476968 2:82803486-82803508 CATTGCACTGGGGGTGGTGTTGG - Intergenic
933659163 2:84913257-84913279 GCTAACACTGGGGGTGGTGTGGG + Intergenic
934177693 2:89591233-89591255 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
934287992 2:91665534-91665556 TGTTCCAGTGGAGGTGGTGAAGG + Intergenic
935530603 2:104228563-104228585 GGTTGCAATGGGTCTGGTGCAGG - Intergenic
936456962 2:112682608-112682630 ACTTCCAGTGGGGGTGTTGCTGG + Intergenic
937310156 2:120897109-120897131 CGTGTCAGTGGGGGTGGTGCTGG - Intronic
937680712 2:124641183-124641205 GGTTGAACTGAGCGTGGTGCTGG - Intronic
938169975 2:129066855-129066877 GGCACCACTGGGGCTGGTCCAGG + Intergenic
938653911 2:133411515-133411537 TTTTCCACTGGGGCTGGTGGAGG + Intronic
940034661 2:149301450-149301472 TGTTCCATTGGAGGTGGTGGAGG + Intergenic
943314117 2:186364643-186364665 AGTTCCAGTGGGGGTGGTGGGGG - Intergenic
945794300 2:214342689-214342711 TTTTCCACTGGGGGTGGTTTTGG - Intronic
946417509 2:219547780-219547802 GGGTCCACTGGGGCTGTTGCTGG + Exonic
947117934 2:226791642-226791664 GGGTCCCCTGGCGGTGGTGGCGG - Intronic
947704741 2:232265167-232265189 GGTTTCAAAGGGGCTGGTGCAGG - Intronic
947753164 2:232543215-232543237 GGTTCCTCTGTGGGTGGGGGAGG + Intronic
948087786 2:235265818-235265840 GGGTCCACTGCGGGTGATGCTGG - Intergenic
948177876 2:235958407-235958429 GTGTCCGCTGGGGGAGGTGCTGG - Intronic
948639318 2:239364508-239364530 GGTTCCCCTGGGAGGGGTGGGGG + Intronic
1168856039 20:1009787-1009809 GATTCCACTGGGGTTGGTGAGGG - Intergenic
1169340884 20:4795433-4795455 GGTCCCAGTGGGGAGGGTGCTGG + Intronic
1169916296 20:10686951-10686973 GTTTCCACTGGGGGCAGAGCTGG - Intergenic
1170558136 20:17531662-17531684 GGTTCCACTGGGGACTGTGAAGG + Intronic
1171206815 20:23287968-23287990 GCTGCCTCTGGGAGTGGTGCTGG - Intergenic
1172110007 20:32539014-32539036 GGCTCCAGTGGGGGTGGGGTGGG + Intronic
1174358564 20:50014314-50014336 GATCTCACTGGGGATGGTGCAGG + Intergenic
1174391514 20:50220897-50220919 GGTACCCTTAGGGGTGGTGCTGG + Intergenic
1176172281 20:63701400-63701422 GGCTGCCCTGGGGGTGGGGCTGG + Intronic
1176819627 21:13644069-13644091 TGTTGCACTGGAGGTAGTGCTGG - Intergenic
1178898818 21:36583016-36583038 GGTGGCACTGGGGATGTTGCTGG - Intergenic
1180245511 21:46544793-46544815 GGGTCCACATGGGGTGCTGCTGG - Intronic
1180647042 22:17347835-17347857 GGTCCCAGTGGACGTGGTGCGGG - Intergenic
1181058374 22:20270411-20270433 GCTTCCAGTGGGGAGGGTGCTGG - Intronic
1181852683 22:25761371-25761393 TGTTCCACAGGTGGTGGTGGTGG + Intronic
1183988724 22:41584052-41584074 GGTTCCACTGGTGGTGAGGGAGG + Exonic
1184279139 22:43427136-43427158 GGTCCCACTGTATGTGGTGCTGG - Intronic
1184804923 22:46788557-46788579 GGTCCCAGTGGGGCTGGTGCTGG - Intronic
949202362 3:1394310-1394332 GGCTCCACTGGAGCTGGAGCTGG + Intronic
949535115 3:4989443-4989465 GGATAAACAGGGGGTGGTGCTGG - Intergenic
949624335 3:5850252-5850274 GATTTCTCTGGGGGTGGTGTTGG + Intergenic
950103739 3:10375349-10375371 GGAATCACTGGGGCTGGTGCTGG - Intronic
950377024 3:12580454-12580476 CGTCTCACTGGGGGTGGTGGCGG - Intronic
950419153 3:12886746-12886768 GGTGACACTGGGGGTGCTACGGG + Intergenic
950665773 3:14493951-14493973 TGTTCCTCTGTGTGTGGTGCTGG - Intronic
950679489 3:14575315-14575337 GAATCACCTGGGGGTGGTGCGGG - Intergenic
950923036 3:16715016-16715038 TGTTGCACTGGAGGTGGTGCTGG + Intergenic
953755677 3:45643821-45643843 GGGTCCACTTGGGATGGTGCTGG + Intronic
954381326 3:50220729-50220751 GGTTCTGCTGAGGGTGGGGCTGG + Exonic
954864282 3:53715775-53715797 GGCTCCACTGAGGGTGAGGCAGG - Intronic
955330267 3:58041530-58041552 AGTCCCACTGGTGGTGGTGGTGG - Intronic
957853749 3:85845969-85845991 GGTTCTACTGGGGTTGGTGGTGG + Intronic
961647658 3:128401003-128401025 GGTTCATCAGGGGGTGGAGCAGG + Intronic
961658514 3:128456276-128456298 GGTGGCAGTGGGGTTGGTGCAGG + Intergenic
962057006 3:131883255-131883277 GGTAACACTGGGGGAGGGGCAGG - Intronic
962065967 3:131981080-131981102 TGTTCCAGTGGAGGTGGTGGGGG + Intronic
965020191 3:163218740-163218762 GGTTCCCCTGGGGCTAGGGCTGG + Intergenic
965032625 3:163391998-163392020 GGTTTCAGTGGTGGGGGTGCTGG - Intergenic
967214596 3:187199550-187199572 GGTTCCACTGCTCCTGGTGCTGG + Exonic
967266859 3:187698990-187699012 GGTTCCACTGCTCCTGGTGCTGG - Exonic
968531149 4:1092355-1092377 AGTTCTACTGAGGGTGGAGCTGG + Intronic
968761060 4:2442943-2442965 GGAGCCACTGGGGGTGCTGGGGG + Intronic
968761089 4:2443009-2443031 GGAGCCACTGGGGGTGCTGGGGG + Intronic
968902195 4:3437005-3437027 GGCCCCTCTGGAGGTGGTGCAGG + Intronic
968920543 4:3520120-3520142 GGTGCCACTGAGGGAGTTGCTGG + Exonic
969621241 4:8280000-8280022 GGTACAACTGGGGCTGCTGCGGG + Intronic
974603697 4:64122337-64122359 GGTTGCACTGGTGCTGGTGTTGG + Intergenic
975361538 4:73476905-73476927 GGTCCCACTGGTGGTCGTGTTGG + Intergenic
975680258 4:76868629-76868651 TGTTCCAGTGGAGGTGGTGGAGG - Intergenic
976856533 4:89610529-89610551 TGTTCCATTGGAGGTGGTGGGGG - Intergenic
977518550 4:98052429-98052451 GTTACCACTTGGGGTGGAGCAGG - Intronic
977518898 4:98056298-98056320 TGTTGCACTGGAGGTGGTGTTGG - Intronic
980576345 4:134687727-134687749 GCTTACACTGGTGGTGGTGGTGG + Intergenic
983858531 4:172675483-172675505 GGTGGCACTGGAGGTGGTGTTGG + Intronic
984029060 4:174580809-174580831 GGACACACTGTGGGTGGTGCAGG + Intergenic
984821883 4:183889412-183889434 GTTTCCTCTGGGGGTGCTGCAGG - Intronic
985603427 5:846596-846618 GTTTCCACTGAGGATGGTGGAGG - Intronic
985603477 5:846869-846891 GTTTCCACTGAGGATGGTGGAGG - Intronic
987053478 5:14167820-14167842 TGTTCCACTGGTGGTGGGTCAGG - Intronic
988336464 5:29914267-29914289 TGTTGCACTGGAGGTGGTGTGGG - Intergenic
988395314 5:30690624-30690646 GCTTTCACTGGGGCTGGTGGAGG - Intergenic
991437392 5:66610603-66610625 AGTTCCACTGGGGGTGCTGAAGG + Intronic
992048023 5:72916843-72916865 GAATCCACTGGAGTTGGTGCTGG - Intergenic
995188021 5:109291225-109291247 TGTTGCACTGGAGGTGGTGTTGG - Intergenic
995371712 5:111426639-111426661 GGTACCATTGGGGGTGGGGGAGG - Intronic
995675503 5:114658534-114658556 GGTTCCACTGGGGATAGAGCAGG + Intergenic
997234222 5:132263497-132263519 AGGTCCACTGGGGGTGGGGGTGG + Intronic
998003837 5:138644262-138644284 GGTTGCCTTGGGGGTGGTGTGGG + Intronic
998755920 5:145379427-145379449 GGTTGTACTGGAGGTGGTGTTGG + Intergenic
999016880 5:148116434-148116456 GGTTCCAGTGGTGGTGGAGGAGG + Exonic
1001248323 5:170123104-170123126 GGGTGCACTGGGGGTGGAGTAGG + Intergenic
1001828276 5:174764292-174764314 GTTCCTACTGAGGGTGGTGCTGG + Intergenic
1002170491 5:177371689-177371711 GGTGCCACTGGGCGTGGAACAGG + Intronic
1002531993 5:179852729-179852751 GGTGGCACTGGGGCTGGAGCAGG + Intronic
1002971869 6:2031264-2031286 AGTGCCACTGGGCTTGGTGCTGG + Intronic
1006003678 6:30986504-30986526 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003712 6:30986684-30986706 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003728 6:30986774-30986796 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003746 6:30986864-30986886 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003766 6:30986954-30986976 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003800 6:30987134-30987156 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003809 6:30987179-30987201 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003818 6:30987224-30987246 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1006003828 6:30987269-30987291 GGTCCCACTGGAGGTCGTGCTGG - Exonic
1006003846 6:30987359-30987381 GGCCCCACTGGAGGTCGTGCTGG - Exonic
1006003863 6:30987449-30987471 GGCCCCACTGGAGGTTGTGCTGG - Exonic
1010509858 6:76704985-76705007 CTTCCCTCTGGGGGTGGTGCGGG - Intergenic
1011893252 6:92193796-92193818 TGTTCCAGTGGAGGTGGTGGGGG + Intergenic
1013422665 6:109979946-109979968 GGGTACACTGGCTGTGGTGCTGG + Exonic
1014183460 6:118409012-118409034 TGTTGCACTGGAGGTGGTGTTGG - Intergenic
1015838095 6:137444219-137444241 GTTTTCACTGGTGGTGGTGGTGG + Intergenic
1018156735 6:160992022-160992044 GGTTCCGGTGGCGGTGGTGGCGG - Exonic
1018738744 6:166711081-166711103 GTGTCCACTGGTGGTGGTGGAGG + Intronic
1019455262 7:1123462-1123484 GGATCCACTGGGGGAGGGGAGGG + Intronic
1022361951 7:29669291-29669313 GGTTCCAGTGGGGAGGGGGCAGG - Intergenic
1022518342 7:30989542-30989564 GGCTCTGCTGGGCGTGGTGCGGG - Intronic
1023754685 7:43405593-43405615 GGGGACAGTGGGGGTGGTGCTGG + Intronic
1024522701 7:50319967-50319989 GGTTTCCCTGGGGAAGGTGCAGG + Intronic
1025189804 7:56887835-56887857 GGATCCTCTGGGGGTGGCTCAGG + Intergenic
1025682135 7:63689086-63689108 GGATCCTCTGGGGGTGGCTCAGG - Intergenic
1026164810 7:67900398-67900420 GGTACCACCAGGGGTGGTGTGGG + Intergenic
1027202887 7:76074099-76074121 GGTTCCAGGGGGGCTGGTGTGGG + Intergenic
1029046054 7:97630043-97630065 GGTTCCAATGGTGGTGCTGCTGG - Intergenic
1029665661 7:101993465-101993487 GGATCCTCTGGGGGTGGCTCAGG + Intronic
1031796839 7:126185915-126185937 ACTTCCACTGGGGCAGGTGCTGG - Intergenic
1032977291 7:137240216-137240238 TGTTCTACTGGTGGTGGTGGTGG - Intronic
1033539737 7:142345475-142345497 GGGTCCTCTGGGTGAGGTGCTGG - Intergenic
1034518318 7:151599549-151599571 TTTTCCACTGGGGGTGGTAGTGG + Intronic
1034617991 7:152435722-152435744 GGCTCCTCGGGGGGTGGTGGCGG + Exonic
1036156924 8:6350792-6350814 CTTTCCACTGGGGGTAGTTCTGG + Intergenic
1039271178 8:35882547-35882569 GGTTCCTTTGGGGGTGGGGAGGG - Intergenic
1042629480 8:70801233-70801255 AGTTCCTCTAGGTGTGGTGCTGG + Intergenic
1043235641 8:77862200-77862222 GGTTACACTGAAGGTGGTGATGG + Intergenic
1043983183 8:86664091-86664113 GGTTGCTCTGGGGATGGTGCTGG + Intronic
1044793549 8:95872643-95872665 GGTCACACTGGTGGTGGTGTTGG - Intergenic
1045779877 8:105850081-105850103 TGTTCCAGTGGAGGTGGTGGAGG - Intergenic
1047748666 8:127864152-127864174 GTTTGCAGTGGGGGTGGGGCAGG + Intergenic
1047807271 8:128373522-128373544 GGTGCCAGTGGTGCTGGTGCTGG + Intergenic
1048261610 8:132949976-132949998 GCTTCCAGTGATGGTGGTGCTGG - Intronic
1049223110 8:141436856-141436878 GGCTTCCCTGGGGGTGGTGGCGG + Intergenic
1051604230 9:18905014-18905036 GGTTCCACTGGGGGTGGTGCTGG - Intronic
1053192166 9:36081482-36081504 GGATACATTGGGGGTGGTGGTGG - Intronic
1053451430 9:38197322-38197344 GGTTCCACCTTGGGTGGTTCTGG + Intergenic
1055577108 9:77671355-77671377 GGCTCCTCTGGGGTTGGTTCTGG + Intergenic
1056389618 9:86128871-86128893 GGTGCTAATGGTGGTGGTGCAGG + Intergenic
1057723901 9:97554847-97554869 GGAGCCACTGGGGGATGTGCAGG + Intronic
1059440806 9:114305875-114305897 CCTTCCACTGGGGGTGGCGGAGG - Intronic
1059514420 9:114879632-114879654 GTTTCCACTGGGTGTGGAGGTGG + Intergenic
1060367577 9:123034060-123034082 GGTGCCAGTAGGGGTGGAGCGGG + Intronic
1060806549 9:126581194-126581216 GGTCCCTCTGGGGTTGGGGCAGG + Intergenic
1061472272 9:130835825-130835847 GGCTCTACCGGGGCTGGTGCCGG - Intronic
1062234098 9:135499961-135499983 GGTTCCTCTGCGGGTGGGTCCGG + Intronic
1062433541 9:136536145-136536167 GGTTGCCCCAGGGGTGGTGCAGG - Intronic
1062491523 9:136807365-136807387 GCTTCCACTGGGGGTTCTGCGGG + Intronic
1203527733 Un_GL000213v1:105501-105523 TGTTGCACTGGAGGTAGTGCTGG + Intergenic
1203444892 Un_GL000219v1:45471-45493 GGCTCCACTGGGGGAGCTGAAGG - Intergenic
1185594672 X:1298745-1298767 GGTTACACTGGGGGTCATGTGGG - Intronic
1189940604 X:46117243-46117265 AGTTGCACTGGAGGTGGTGTTGG + Intergenic
1190296336 X:49029956-49029978 GGTTCCTTTGGGGAAGGTGCAGG + Exonic
1190325381 X:49204168-49204190 GGTAGCATTGGGAGTGGTGCAGG - Intergenic
1190840012 X:54135056-54135078 GGTCCCACTGGGAATGGTGGTGG + Exonic
1191083323 X:56537516-56537538 ACTTGCAGTGGGGGTGGTGCGGG + Intergenic
1192014570 X:67315675-67315697 TGTTCCAGTGGAGGTGGTGGAGG + Intergenic
1192229370 X:69254610-69254632 GATTTCACTGGGGGTGGGGAAGG + Intergenic
1192995084 X:76505154-76505176 TGTTCCAGTGGAGGTGGTGGTGG + Intergenic
1194663929 X:96656306-96656328 GGTTGCACTGGAGGTGGTGTTGG - Intergenic
1195076785 X:101334932-101334954 TGTTCCACTAGGGGTGGGGGTGG - Intergenic
1195751854 X:108167703-108167725 GGTTCCTGTGGGGGTGGGGTGGG + Intronic
1199242896 X:145568963-145568985 GGTGCCAGTGGTGGTGGTGGTGG - Intergenic
1200149597 X:153944713-153944735 GGTTCCGCTGGGCCTGGGGCGGG + Intergenic
1201238904 Y:11938902-11938924 TGTTCCACTGATGGTGGTGGTGG - Intergenic