ID: 1051605028

View in Genome Browser
Species Human (GRCh38)
Location 9:18909992-18910014
Sequence TCAGGCCACGCGAGGGAAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051605028_1051605033 -9 Left 1051605028 9:18909992-18910014 CCTCCTTCCCTCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1051605033 9:18910006-18910028 GTGGCCTGAGTTTAGGAGCAAGG 0: 1
1: 0
2: 2
3: 17
4: 168
1051605028_1051605036 -5 Left 1051605028 9:18909992-18910014 CCTCCTTCCCTCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1051605036 9:18910010-18910032 CCTGAGTTTAGGAGCAAGGGTGG 0: 1
1: 0
2: 1
3: 15
4: 208
1051605028_1051605034 -8 Left 1051605028 9:18909992-18910014 CCTCCTTCCCTCGCGTGGCCTGA 0: 1
1: 0
2: 0
3: 17
4: 135
Right 1051605034 9:18910007-18910029 TGGCCTGAGTTTAGGAGCAAGGG 0: 1
1: 0
2: 0
3: 11
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051605028 Original CRISPR TCAGGCCACGCGAGGGAAGG AGG (reversed) Exonic