ID: 1051607367

View in Genome Browser
Species Human (GRCh38)
Location 9:18928727-18928749
Sequence CTCCCCCATCAGGCCCCGGT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051607362_1051607367 7 Left 1051607362 9:18928697-18928719 CCTGGCTAGAGGTTTCAAGCTCT 0: 1
1: 0
2: 3
3: 13
4: 114
Right 1051607367 9:18928727-18928749 CTCCCCCATCAGGCCCCGGTAGG 0: 1
1: 0
2: 1
3: 22
4: 166
1051607361_1051607367 15 Left 1051607361 9:18928689-18928711 CCAGGAGGCCTGGCTAGAGGTTT 0: 1
1: 0
2: 2
3: 15
4: 176
Right 1051607367 9:18928727-18928749 CTCCCCCATCAGGCCCCGGTAGG 0: 1
1: 0
2: 1
3: 22
4: 166
1051607360_1051607367 16 Left 1051607360 9:18928688-18928710 CCCAGGAGGCCTGGCTAGAGGTT 0: 1
1: 0
2: 1
3: 11
4: 188
Right 1051607367 9:18928727-18928749 CTCCCCCATCAGGCCCCGGTAGG 0: 1
1: 0
2: 1
3: 22
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051607367 Original CRISPR CTCCCCCATCAGGCCCCGGT AGG Exonic
900188989 1:1345426-1345448 CTCCCCCATCTGGCTGGGGTGGG - Intronic
900682656 1:3925357-3925379 CTCCCAAAGCAGGCCCAGGTAGG - Intergenic
906150304 1:43583658-43583680 CTGCCCCATTAAGCCCTGGTGGG - Intronic
910307872 1:85787374-85787396 CTCCACCAACAGGCCCCAGTGGG + Intronic
916950753 1:169777986-169778008 ATCCCACAACAGGCCCCAGTGGG - Intronic
918853732 1:189724282-189724304 ACCCCCCAACAGGCCCTGGTGGG + Intergenic
920037603 1:203076039-203076061 CTCCCCCGTCAGACCCGGGGCGG - Intronic
920194389 1:204217178-204217200 TTCCCACATCAGGCCCCTGCAGG + Intergenic
923994168 1:239472708-239472730 CACCCCCAACAGGCCCTAGTGGG - Intronic
924527323 1:244863939-244863961 CTCCTCCATCGGGCCCGAGTCGG + Exonic
1067689300 10:48491138-48491160 ATCCCCCAGCAGGCCCCTCTTGG + Intronic
1073042243 10:100615610-100615632 CTCCCGCTGCAGGCCCCGCTGGG + Intergenic
1075185924 10:120257019-120257041 GACCCCCAACAGGCCCTGGTGGG + Intergenic
1075685008 10:124357673-124357695 CTCCACCATCAGGCGTGGGTGGG - Intergenic
1077065980 11:641093-641115 CTGCCCCAGCAGACCCCGGCAGG + Intergenic
1077945020 11:6887736-6887758 ATCCCCCGACAGGCCCCGGTGGG + Intergenic
1078422490 11:11223942-11223964 CACCCACAACAGGCCCCTGTAGG - Intergenic
1080112184 11:28580924-28580946 CTCACCTATCAGCCCCAGGTAGG - Intergenic
1080138406 11:28885507-28885529 CACCCCCCACAGGCCCCAGTGGG - Intergenic
1080569321 11:33542103-33542125 GTCCCCCTTTAGGCCCCGGTTGG - Intronic
1081730674 11:45369754-45369776 CTGCCCCCTCAGGCTCGGGTCGG + Intergenic
1083785959 11:64947378-64947400 CTCCCCCAGCAGGCCAGGGCTGG - Exonic
1083890705 11:65594413-65594435 GTCTCCCATCTGGCTCCGGTAGG - Intronic
1084165719 11:67373876-67373898 CTCCCCCAGGAGGCCCAGGGTGG - Intronic
1084235452 11:67785366-67785388 CTCTCCGTTCAGGGCCCGGTAGG + Intergenic
1084608874 11:70188080-70188102 CGCTCCCACCAGGGCCCGGTGGG + Exonic
1084975145 11:72792984-72793006 TTCCTCCATCAGGCCAAGGTGGG + Exonic
1091776068 12:3185704-3185726 CTGCCCCATCAGGCCTCAGGCGG - Intronic
1091785320 12:3239771-3239793 CTTCCCCATCAGGACCCTGTCGG - Intronic
1092204401 12:6606709-6606731 CTCCCCCGTCACACCCCGCTCGG - Intronic
1093493022 12:19726127-19726149 CTCCACCTTCAGGCCACGGGTGG - Intergenic
1094053903 12:26249263-26249285 CTCTCCCATCACCCCCAGGTGGG - Intronic
1098004654 12:65983194-65983216 ACCCCACAACAGGCCCCGGTAGG - Intergenic
1100054013 12:90487322-90487344 CACCCCCGACAGGCCCCGGTGGG + Intergenic
1102051002 12:109861962-109861984 CTCCCCTGTGAGGCCCCGCTAGG + Intronic
1103540648 12:121664096-121664118 CTCCCCTTGCAGGCCCGGGTGGG - Intronic
1104406471 12:128521462-128521484 ACCCCCCAACAGGCCCCGGTGGG + Intronic
1106348880 13:28908299-28908321 ACCCCACAACAGGCCCCGGTGGG + Intronic
1109389737 13:61677863-61677885 ATCCCCCAACAGGCCCCAGTGGG + Intergenic
1111676902 13:91399083-91399105 CTCCTCCTTCTGGCCCTGGTTGG + Exonic
1112076007 13:95914080-95914102 ATCCCTCAACAGGCCCTGGTGGG - Intronic
1113711338 13:112467284-112467306 CTCCCCCAGGAGCCCCAGGTGGG + Intergenic
1114473883 14:22981286-22981308 CTCCCGCATCCGGGCCCGGGCGG + Exonic
1115407041 14:33028979-33029001 CTCCCCCATCAGGGGCGGGGGGG - Intronic
1117727307 14:58687359-58687381 CTCCCCCAGCCGGCCGCGGTGGG - Intergenic
1117959774 14:61151580-61151602 CTCCCTCATCAGGCCATGCTTGG + Intergenic
1119425568 14:74532582-74532604 CTGCTCCATCAGGCCTCCGTGGG - Intronic
1122857655 14:104567528-104567550 TTCCCACCTCAGGCCCCGGAGGG - Intronic
1123037515 14:105477498-105477520 CAGCCCCATCAGGGCCCAGTTGG + Intronic
1123068992 14:105632062-105632084 CTGCCCCCTCTGGCCCAGGTGGG + Intergenic
1124609840 15:31200941-31200963 CTTCCCCAGCAGGCCCTGGAGGG - Intergenic
1124631271 15:31338933-31338955 CTCCCTCCTCAGGCCCCCCTGGG - Intronic
1127832302 15:62761669-62761691 TTCTCCCATCAGGCCCTGGATGG + Exonic
1128111124 15:65076874-65076896 CTCCACCAGCAGGGCGCGGTCGG - Exonic
1128323015 15:66705751-66705773 CTCCCCCATAAATCCCTGGTGGG - Intronic
1128388049 15:67164648-67164670 CTCACCCACCAGTCCCCGGTGGG - Intronic
1132867379 16:2100182-2100204 CTTCTCCACCAGGCCCCCGTTGG + Exonic
1133347017 16:5078000-5078022 CTCTCCGTTCAGGGCCCGGTAGG + Exonic
1134524398 16:14932933-14932955 CTTCTCCACCAGGCCCCCGTTGG - Intronic
1134548503 16:15128008-15128030 CTTCTCCACCAGGCCCCCGTTGG + Intronic
1134633297 16:15772915-15772937 GTCCCCCATCACCCCCCGATGGG + Intronic
1134711986 16:16331420-16331442 CTTCTCCACCAGGCCCCCGTTGG - Intergenic
1134719844 16:16374713-16374735 CTTCTCCACCAGGCCCCCGTTGG - Intergenic
1134947582 16:18337172-18337194 CTTCTCCACCAGGCCCCCGTTGG + Intergenic
1134954842 16:18377274-18377296 CTTCTCCACCAGGCCCCCGTTGG + Intergenic
1135212840 16:20538933-20538955 CTCCACCACCAGACCCCTGTGGG + Intronic
1137384924 16:48032601-48032623 ATCCCACATCAGGCCCTGCTAGG - Intergenic
1138352478 16:56353298-56353320 CTCCCAAGTCAGGCCCCAGTGGG - Intronic
1139324039 16:66138030-66138052 CTCCCCCATCAGGCATCTTTGGG + Intergenic
1139367465 16:66442228-66442250 CTTCTCCATCAGGCCCCAGCTGG + Intronic
1139392386 16:66613050-66613072 CTGCCCCGCCAGGCCCCGGTGGG + Exonic
1140462259 16:75148990-75149012 CGCCCCCACCACGCCCCGGCGGG - Intronic
1141614327 16:85202127-85202149 GGCCCCCATCAGGGCCCGGGCGG + Intergenic
1142643590 17:1298827-1298849 CTCCCCCGGCAGGCACCTGTGGG + Exonic
1142680528 17:1545382-1545404 CTCTCCCATCAGCCCCCAGAGGG + Intronic
1143633249 17:8150673-8150695 CTCCCCCATCAGCCCCTTCTAGG + Exonic
1148111926 17:45149361-45149383 CTTCCCCCTCCGGCCCCGGACGG - Exonic
1148591031 17:48816982-48817004 CTCCCCCGTCTCGCCCCGCTGGG + Exonic
1149994696 17:61400334-61400356 CGCCCCCGCCAGGCCCGGGTCGG - Exonic
1151370210 17:73643028-73643050 CGCCCCCAGCAGGCGCCGCTCGG + Intronic
1151722121 17:75863158-75863180 CTCCCATCTGAGGCCCCGGTGGG + Intergenic
1152061257 17:78077266-78077288 CTCCCCAGTCAGGCCCTGGGTGG + Exonic
1152197065 17:78924449-78924471 CTCCCCGATCAAGCCAGGGTGGG - Intronic
1152819314 17:82428464-82428486 CTTCCTCATCAGGCCCTGGGGGG - Intronic
1154174518 18:12076659-12076681 CTCGCCCAGCAGGCCCCGGCCGG - Intergenic
1155633738 18:27925710-27925732 CACCCCCGGCAGGCCCTGGTGGG + Intergenic
1157065822 18:44349544-44349566 ACCCCCCAACAGGCCCCGGTGGG + Intergenic
1158747728 18:60220396-60220418 ACCCCACAACAGGCCCCGGTGGG + Intergenic
1160859770 19:1232855-1232877 TTTTCCCATCAGGCCCCGGATGG - Intronic
1160871437 19:1279631-1279653 CTCCCCCATCTGCCTCCTGTGGG + Intergenic
1162145333 19:8609608-8609630 CTCCTCCCGCAGGCCCCGGCTGG - Intronic
1162830607 19:13282141-13282163 CTCCCCCATCAGGTCCCCAGGGG + Intronic
1163290637 19:16377068-16377090 CCCCGCCATCCGGCACCGGTAGG + Intronic
1165632287 19:37312191-37312213 ATCCCCCATCAGGCCCCTTCTGG + Intergenic
926142344 2:10375181-10375203 CTGCCCCAGCAGGCCCTGGCTGG + Intronic
926217515 2:10914460-10914482 CTCCCCCTGCAGGCCCAGGATGG + Intergenic
928166433 2:28975913-28975935 CTCCACCAGCAGGGCCCAGTGGG - Intronic
930359877 2:50364073-50364095 AACCCCCAACAGGCCCCAGTGGG - Intronic
932597217 2:73101569-73101591 ATCCACCATCAGTCCCAGGTGGG - Intronic
934953184 2:98593152-98593174 TTCCTGCATCAGGCCCCTGTGGG + Intronic
935279677 2:101506559-101506581 CTCCCTCATAAGGGCCAGGTGGG - Intergenic
937288098 2:120765650-120765672 CCCCTCCATCAGGACCCGTTAGG + Intronic
938331970 2:130454385-130454407 CTCCTCCATCAGCCCCCAGGTGG + Intergenic
940417554 2:153440108-153440130 CACCCCCAACAGGCCACAGTGGG + Intergenic
943660907 2:190558305-190558327 AACCCCAAACAGGCCCCGGTGGG - Intergenic
946159879 2:217829650-217829672 CTCCCCCATCAGGACTCAGGAGG + Intronic
948105043 2:235406569-235406591 CTCCCCCCTCAAGCACAGGTTGG + Intergenic
948920651 2:241064490-241064512 CTCCCTAATCAGCCCCCAGTGGG + Intronic
949022345 2:241748697-241748719 CTCCACCTTCAGCCCCTGGTGGG + Intronic
1168970387 20:1926835-1926857 CTCCCTCATTAGGCCCTGGAGGG + Intronic
1171865332 20:30484757-30484779 CTCCCCCAACAGGCCCTGTGTGG - Intergenic
1175309610 20:58002679-58002701 CCCCCCTGACAGGCCCCGGTTGG - Intergenic
1179552303 21:42151021-42151043 CTGCCCCATCAGGCCCCTCCTGG + Intergenic
1180711563 22:17842688-17842710 CTTCCCCATCAGTCCTCCGTGGG + Intronic
1180847524 22:18992107-18992129 CTCCCCCTTCAGCCCCCTGTGGG + Intergenic
1181574080 22:23782995-23783017 CTCCCACATCAGGACCCACTGGG + Intronic
1181618169 22:24069641-24069663 CTCCCACATCAGCACCCTGTAGG + Intronic
1181644993 22:24226240-24226262 CTCCCCCAGCAGGTCCCGGGAGG + Exonic
1182472411 22:30556621-30556643 CGCCCCCACCAGGGCCCCGTTGG + Intronic
1182762939 22:32737473-32737495 ACCCCACAACAGGCCCCGGTGGG + Intronic
1183149726 22:36028351-36028373 CTCCCGCTTCATGCCCCGGGCGG + Exonic
1183656117 22:39185657-39185679 CTCCACCAGCAGGCCTGGGTGGG + Intergenic
1184790074 22:46694875-46694897 CTCCTCCATCAGGCCCCTGCAGG + Intronic
1184947963 22:47817821-47817843 CTCACCCATCAGGCCTGGGAGGG + Intergenic
1185322653 22:50209064-50209086 CTCCCCAGTCAGGACCCGGCTGG - Intronic
950569394 3:13790749-13790771 CTGCCCCTTCAGGCCCAGGGTGG + Intergenic
951951014 3:28200362-28200384 CTCCACCTGCACGCCCCGGTGGG - Intergenic
953053321 3:39366217-39366239 CACCCCCAACAGCCCCCAGTAGG - Intergenic
954405005 3:50340794-50340816 CTCCCCCGACATGGCCCGGTTGG + Exonic
956462227 3:69484279-69484301 CTTCCCCATCCAGCCCCTGTGGG - Intronic
957051422 3:75415163-75415185 CTCTCCATTCAGGGCCCGGTAGG + Intergenic
958184628 3:90105142-90105164 ACCCCACAACAGGCCCCGGTGGG + Intergenic
961366968 3:126406373-126406395 CTCCCCCATCCCGCCCCAGGAGG + Intronic
961504826 3:127363030-127363052 CTCCCCCACCCAGCCCCGGAAGG + Intergenic
961885013 3:130091354-130091376 CTCTCCGTTCAGGGCCCGGTAGG + Exonic
967935974 3:194727932-194727954 CTTCCCCCTCAGGCCCTGGGGGG + Intergenic
968438601 4:609800-609822 CTGCCCCTTCAGGCTCAGGTGGG + Intergenic
968900799 4:3430854-3430876 CTCCCCCATCAGGGTCAGCTCGG - Exonic
968994201 4:3935542-3935564 CTCTCCGTTCAGGGCCCGGTAGG + Intergenic
969266896 4:6070438-6070460 CTCTCCCTTCAGCCCGCGGTTGG - Intronic
969652499 4:8476014-8476036 CTCCCCAACCAGGCCTCGGCTGG - Exonic
969721335 4:8894339-8894361 CTCTCCCACCAGGCCCCGGCGGG + Intergenic
971085178 4:23266621-23266643 CTCCCCCATCACCCCCCGACAGG - Intergenic
975064954 4:70049235-70049257 CCCCACCACCAGGCCCTGGTGGG + Intergenic
976495124 4:85720097-85720119 ACCCCACAACAGGCCCCGGTGGG - Intronic
980180218 4:129392729-129392751 CTCCACCTTCAGGCCAGGGTGGG + Intergenic
980738265 4:136918181-136918203 CTCCACCTTCAGGCCAGGGTGGG + Intergenic
983705885 4:170658982-170659004 ACCCCACAACAGGCCCCGGTGGG + Intergenic
1202757123 4_GL000008v2_random:74819-74841 ACCCCCCAACAGGCCCCAGTGGG - Intergenic
989724892 5:44576249-44576271 ACCCCACAACAGGCCCCGGTGGG + Intergenic
992125232 5:73633005-73633027 GTCTCCCATCAGCCCCAGGTAGG - Intronic
992764573 5:79985373-79985395 TTCCCCAATCAGGCCACTGTTGG + Intronic
1001060346 5:168483040-168483062 ACCCCACAACAGGCCCCGGTGGG + Intergenic
1001392157 5:171388035-171388057 CACCGCCACCAGGCCCCGCTCGG - Intronic
1002107555 5:176887596-176887618 CTCCTCCAGCAGGCGCCGGTGGG + Exonic
1003638644 6:7858048-7858070 CTCCCCCATCAGGGTCAGGTAGG - Intronic
1006296970 6:33174041-33174063 CTTCCCCGACAGGCCCTGGTGGG + Exonic
1008089108 6:47275487-47275509 ACCCCCCAACAGGCCCCGGTGGG - Intronic
1011766846 6:90629543-90629565 ATCCCCCAAGAGGCCCTGGTGGG - Intergenic
1012347407 6:98207690-98207712 CACCCCCGACAGGCCCTGGTGGG - Intergenic
1020120484 7:5500550-5500572 CTTCCCCATCATGCCCAGGTTGG + Exonic
1020268312 7:6576704-6576726 CGCCCCCACCAGGCCCAGGTCGG + Intergenic
1020318484 7:6923908-6923930 CTCTCCGTTCAGGGCCCGGTAGG + Intergenic
1025042752 7:55662415-55662437 CTCCTCCTTCAGGCCCTGGACGG - Intergenic
1035976688 8:4320516-4320538 ACCCCCCAACAGGCCCCAGTGGG + Intronic
1036434890 8:8723849-8723871 CACCCCCAACAGGCCCCGGTGGG - Intergenic
1036985188 8:13521234-13521256 CCCCTCCAACAGGCCCCAGTGGG - Intergenic
1040042886 8:42934551-42934573 CCCCCGCACCAGGCCCCAGTGGG + Intronic
1040792564 8:51250029-51250051 GCCCCCCAACAGGCCCTGGTAGG - Intergenic
1042236014 8:66613532-66613554 CTCTCCCAGCAGGCCCCGCGCGG - Intronic
1042752386 8:72171917-72171939 CTCCCCTGACAGGCCCCAGTGGG + Intergenic
1045304811 8:100950610-100950632 CTCCTCCCTCTGGCTCCGGTCGG - Intronic
1045414573 8:101953161-101953183 CTGCCCCATCTGCCCCAGGTTGG - Intronic
1049002889 8:139837498-139837520 CTCCCCCACCAGCCCCCTGAAGG + Intronic
1050432101 9:5572584-5572606 CCCCCTCAACAGGCCCTGGTGGG - Intergenic
1051607367 9:18928727-18928749 CTCCCCCATCAGGCCCCGGTAGG + Exonic
1061758112 9:132829669-132829691 CTCACCCATCAGCCCCCTCTTGG + Intronic
1062623638 9:137433576-137433598 CTCCCTCACCAGGCCCAGCTTGG + Exonic
1185736451 X:2500355-2500377 CGCCCCCGCCAGGCCCCGGAGGG - Intronic
1185984102 X:4811295-4811317 CTGCCCCCACAGGCCCCAGTGGG + Intergenic
1186438922 X:9567855-9567877 CTCCTCCATGAAGCCCCTGTAGG + Intronic
1189298778 X:39937425-39937447 CTCGCCCTTCAGACCCAGGTAGG + Intergenic
1189767076 X:44382786-44382808 CACCCCCATCAGACCCTGGAGGG + Intergenic
1190595458 X:52049142-52049164 TACCCACAACAGGCCCCGGTGGG - Intergenic
1190613366 X:52204931-52204953 TACCCACAACAGGCCCCGGTGGG + Intergenic
1190901373 X:54677049-54677071 CTCCTCCAATAGGCCCCAGTGGG - Intergenic
1193568893 X:83116905-83116927 CACCCCCAACAGGCCCCAATGGG + Intergenic
1197177492 X:123500938-123500960 CTCCCCCTTCAGCCCAGGGTAGG + Intergenic
1198804265 X:140477926-140477948 CTCCACCATCAGGGCCCAGAGGG + Intergenic
1199141642 X:144320493-144320515 ACCCCCCAACAGGCCCCGGTGGG - Intergenic