ID: 1051608864

View in Genome Browser
Species Human (GRCh38)
Location 9:18942432-18942454
Sequence ACCCAACCCCTTCACTGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051608857_1051608864 14 Left 1051608857 9:18942395-18942417 CCACCGTTTCTACTGCTGCGCTC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1051608864 9:18942432-18942454 ACCCAACCCCTTCACTGCGGAGG No data
1051608856_1051608864 22 Left 1051608856 9:18942387-18942409 CCACAATGCCACCGTTTCTACTG 0: 1
1: 0
2: 2
3: 13
4: 92
Right 1051608864 9:18942432-18942454 ACCCAACCCCTTCACTGCGGAGG No data
1051608855_1051608864 26 Left 1051608855 9:18942383-18942405 CCAACCACAATGCCACCGTTTCT 0: 1
1: 0
2: 1
3: 12
4: 126
Right 1051608864 9:18942432-18942454 ACCCAACCCCTTCACTGCGGAGG No data
1051608858_1051608864 11 Left 1051608858 9:18942398-18942420 CCGTTTCTACTGCTGCGCTCTCC 0: 1
1: 0
2: 0
3: 14
4: 210
Right 1051608864 9:18942432-18942454 ACCCAACCCCTTCACTGCGGAGG No data
1051608859_1051608864 -10 Left 1051608859 9:18942419-18942441 CCACCTTCCTTCCACCCAACCCC 0: 1
1: 0
2: 21
3: 192
4: 1744
Right 1051608864 9:18942432-18942454 ACCCAACCCCTTCACTGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051608864 Original CRISPR ACCCAACCCCTTCACTGCGG AGG Intronic
No off target data available for this crispr