ID: 1051611838

View in Genome Browser
Species Human (GRCh38)
Location 9:18968910-18968932
Sequence TTAGAGAAGCATAATAAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051611830_1051611838 7 Left 1051611830 9:18968880-18968902 CCCTGCACCCAACCAAAAATATC 0: 1
1: 0
2: 2
3: 18
4: 202
Right 1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG No data
1051611834_1051611838 -5 Left 1051611834 9:18968892-18968914 CCAAAAATATCCCTACTTTTAGA 0: 1
1: 0
2: 2
3: 20
4: 331
Right 1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG No data
1051611833_1051611838 -1 Left 1051611833 9:18968888-18968910 CCAACCAAAAATATCCCTACTTT 0: 1
1: 1
2: 4
3: 22
4: 293
Right 1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG No data
1051611832_1051611838 0 Left 1051611832 9:18968887-18968909 CCCAACCAAAAATATCCCTACTT 0: 1
1: 0
2: 1
3: 26
4: 204
Right 1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG No data
1051611829_1051611838 8 Left 1051611829 9:18968879-18968901 CCCCTGCACCCAACCAAAAATAT 0: 1
1: 9
2: 133
3: 839
4: 3764
Right 1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG No data
1051611831_1051611838 6 Left 1051611831 9:18968881-18968903 CCTGCACCCAACCAAAAATATCC 0: 1
1: 0
2: 0
3: 20
4: 158
Right 1051611838 9:18968910-18968932 TTAGAGAAGCATAATAAGGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051611838 Original CRISPR TTAGAGAAGCATAATAAGGT AGG Intronic
No off target data available for this crispr