ID: 1051612141

View in Genome Browser
Species Human (GRCh38)
Location 9:18971282-18971304
Sequence AGGCAAGCAGCAGTGGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 643
Summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 586}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051612141 Original CRISPR AGGCAAGCAGCAGTGGGGCA TGG (reversed) Intronic
900188575 1:1343958-1343980 AGGCAGGCCGCAGAGGGTCAGGG + Intronic
900514983 1:3077375-3077397 AGTCCAGCAGCAGTGAGGGAGGG - Intronic
900586211 1:3433470-3433492 AGACAGGCAGCAGATGGGCAGGG - Intronic
900703994 1:4067655-4067677 TGGCCAGGAGCAGAGGGGCATGG + Intergenic
901357238 1:8661545-8661567 AGACAAGCAGCAGCTGGGAAGGG + Intronic
901755996 1:11441907-11441929 AGGGAAGGAGGAGTGGGGAAGGG + Intergenic
902236407 1:15060306-15060328 AGGCCAGCAGCAGCGGGGCCTGG + Intronic
902675436 1:18005419-18005441 AGCCCAACATCAGTGGGGCAGGG - Intergenic
902816530 1:18919477-18919499 AGGGAAGCAGAAGTGGGGAGGGG + Intronic
903037125 1:20500122-20500144 AGGCAAGCAGGTGAGGGGAAAGG + Exonic
903127275 1:21256614-21256636 AGGGAAGCAGCAGAGAGACACGG - Intronic
903305076 1:22407665-22407687 TTGCCAGCAGCAGAGGGGCAGGG + Intergenic
903646472 1:24899080-24899102 AAGCTAGCAGCAGTGGGGATTGG - Intergenic
903666624 1:25011934-25011956 AGACAAGAAGGAGGGGGGCAGGG - Intergenic
903859045 1:26354253-26354275 AGGCAAGCACCAGGGGAGGAGGG - Intergenic
904917677 1:33982142-33982164 AGGCAAACAGAAGTGGGTGATGG + Intronic
905121903 1:35688844-35688866 AGTCAGGCAGCAGAGGGCCAAGG + Intergenic
905158565 1:36010446-36010468 ACGCAAAAATCAGTGGGGCATGG + Intronic
905422674 1:37859325-37859347 AAGCAAGGAGGAGAGGGGCAGGG + Intronic
907506075 1:54919145-54919167 CGGCAAACAGCAGTGGTGGACGG + Intergenic
907602277 1:55783545-55783567 CGGCAAACAGCAGTGGTGGATGG + Intergenic
908206091 1:61851387-61851409 AGACAAGTGGCAGTGGGTCAGGG + Intronic
908269878 1:62412230-62412252 AGGAGAGCAGCAGAGTGGCACGG + Intergenic
909007696 1:70296780-70296802 AGGGAAGCAGCAGAGAGGGAAGG + Intronic
910278383 1:85471992-85472014 AGGCTAGCCTCAGTGGGGCATGG - Intronic
910467764 1:87518358-87518380 ATGGAAGCCCCAGTGGGGCAGGG - Intergenic
911935080 1:103960188-103960210 TGGGAAGCAGCAGCGGGGCCAGG - Intergenic
913233797 1:116763433-116763455 AGAAAAGCAGCAGTGGGGCTCGG - Intronic
913408842 1:118527748-118527770 ATGAAAGAAGCAGTGGGACATGG - Intergenic
914255957 1:145961360-145961382 AGGCGTCCAGCAGTGTGGCAAGG + Exonic
914897050 1:151685389-151685411 ATGCAAACAGCTGCGGGGCACGG + Intronic
914902563 1:151718825-151718847 AGGAAAGGAGCAGTGGGGGTGGG - Intronic
917215567 1:172674856-172674878 TGGCAAGCAGCACTGGAGGAGGG - Intergenic
917403535 1:174678931-174678953 TGGCAAACAGCAGTGGTGGATGG + Intronic
917724021 1:177812763-177812785 TGGCAAACAGCAGTGGTGGACGG - Intergenic
918472061 1:184884981-184885003 AGGCAGACCGCAGTGGGACAGGG - Intronic
919082780 1:192886797-192886819 TGGCAAACAGCAGTGGTGGATGG + Intergenic
919205854 1:194420942-194420964 ATGCAAGCTGCAGTGGGGAAGGG - Intergenic
919746695 1:201013428-201013450 AAGGAAGAAGCAGTGTGGCAAGG + Intronic
919932307 1:202229309-202229331 AGGCAGGGAATAGTGGGGCAGGG - Intronic
920029700 1:203029073-203029095 GGGGAAACAGCAGTGGGGGAAGG + Intronic
920525689 1:206664248-206664270 ATGCAGGCAGCACTCGGGCAAGG + Intronic
920639855 1:207741518-207741540 CGGCAAACAGCAGTGGTGGACGG + Intergenic
920663776 1:207943244-207943266 AGGCAAGGAGGGGTGGGGCACGG - Intergenic
921332079 1:214049646-214049668 AGCAGAGAAGCAGTGGGGCAGGG + Intergenic
922876304 1:228942512-228942534 CGGCAAACAGCAGTGGTGGACGG - Intergenic
922877767 1:228953890-228953912 CGGCAAACAGCAGTGGTGGATGG - Intergenic
923109461 1:230879602-230879624 AGGCCAGCAGAGGAGGGGCAGGG - Intergenic
923150205 1:231226278-231226300 AGCGAAGCAGCAGTGGGGAGAGG - Intronic
1064134841 10:12741740-12741762 AGGGAAGCAGGAGAGGGCCAGGG + Intronic
1065222798 10:23513377-23513399 AGGCAAACAGCAGTAGTGGACGG + Intergenic
1066018978 10:31277631-31277653 AAGCAAGCAGGAGTGGGTGATGG + Intergenic
1067166335 10:43869084-43869106 AGGGAAGAGGCAGTGGGCCAAGG + Intergenic
1067310197 10:45105703-45105725 ATGCAAGCACCAGGAGGGCAGGG - Intergenic
1067457263 10:46427891-46427913 AGGCAAGACGCAGTGAGCCAGGG + Intergenic
1067477889 10:46578589-46578611 AGGCAGGCAGCGCTGGGGCCGGG + Intronic
1067552837 10:47247319-47247341 AGGCACCCAGCAGTGGAGGAGGG + Intergenic
1067616849 10:47763198-47763220 AGGCAGGCAGCGCTGGGGCCCGG - Intergenic
1068059544 10:52050140-52050162 AGGGAAGCAGCAGTGAAGTATGG + Intronic
1068791298 10:61034052-61034074 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1068792074 10:61039517-61039539 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1069566099 10:69464458-69464480 AAGAAACCAGCAGTAGGGCATGG - Intronic
1071292896 10:84200509-84200531 GGGCATGCAGCAGTGGGGTCGGG - Intronic
1071326730 10:84525734-84525756 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1071331542 10:84565570-84565592 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1071490505 10:86133367-86133389 TGGTAAGCAGCAGTGGAGAAAGG - Intronic
1072378564 10:94841392-94841414 TGGCAAACAGCAGTGGTGGACGG + Intronic
1072472439 10:95724729-95724751 TGGCAAACAGCAGTGGTGGATGG + Intronic
1072719762 10:97773140-97773162 AGGCAAGCATCAGAGGGGAGGGG + Intergenic
1073705961 10:105984670-105984692 AGGGAAGCAGGAGTGGGCAAAGG + Intergenic
1073771828 10:106743330-106743352 AGCCAGGCAGCAGGAGGGCATGG - Intronic
1073940620 10:108693884-108693906 GGGCAAGCAGAAGCAGGGCAGGG + Intergenic
1074446053 10:113521829-113521851 AGGCAATCAGTGGTGGGGCCAGG - Intergenic
1074446640 10:113526091-113526113 ATACAAGCAGCACTGGGCCATGG + Intergenic
1074567286 10:114592067-114592089 ATGTAGGCACCAGTGGGGCAGGG - Intronic
1074978467 10:118599889-118599911 CGGCAATCAGCAGTGGTGGACGG + Intergenic
1074979527 10:118608574-118608596 AAGGAAGCAGCAGTGGGGCTGGG - Intergenic
1075222424 10:120596662-120596684 AGGGGAGCAGGAGAGGGGCAGGG + Intergenic
1075369189 10:121920460-121920482 AGGCAGGCTGCAGTGAGCCATGG + Intronic
1075442542 10:122491478-122491500 AGGCAGCCAGCAGCAGGGCATGG + Intronic
1075723818 10:124601766-124601788 AGGCAGAGAGCAGTGGGGCCTGG - Intronic
1075951982 10:126486860-126486882 AGGCCAGCAGCACTGGCTCATGG + Intronic
1076110607 10:127856399-127856421 AGCCAAGCAGCACCGGGGCTTGG - Intergenic
1076202994 10:128572988-128573010 AGGTAAGCAGCCCTGGGGCATGG - Intergenic
1076424293 10:130356594-130356616 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1076522339 10:131089114-131089136 CGGCAGGAAACAGTGGGGCAGGG - Intergenic
1079299603 11:19266169-19266191 AGGCAAGCTTCTGTGGGACAAGG - Intergenic
1079601746 11:22317941-22317963 CAGCCAGCAGCAGTGGTGCAGGG + Intergenic
1079674127 11:23203249-23203271 TGGGAAGCAACAGTGGGGCCAGG + Intergenic
1079678730 11:23265149-23265171 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1080220223 11:29894409-29894431 AGGCAATCAGAAGCGGGGAAGGG + Intergenic
1080326222 11:31076632-31076654 AAACAAACAGCAGTTGGGCATGG - Intronic
1080485797 11:32705125-32705147 CGGGAAACAGCAGTGGGGCTAGG + Intronic
1080684955 11:34507508-34507530 CGGCAAGGAGCTCTGGGGCAGGG + Intronic
1081360296 11:42169028-42169050 AGCCATGCACCAGTGAGGCATGG - Intergenic
1081576059 11:44319221-44319243 AGGCAGGCGGCAGGAGGGCAGGG - Intergenic
1081588325 11:44402913-44402935 AGGGAAGCAGCAGAGAGGCAAGG + Intergenic
1081597129 11:44467140-44467162 GGGGAAGCAGGAATGGGGCAGGG + Intergenic
1081659258 11:44877892-44877914 AGGCCAGGAGCAGTGGGGAGAGG - Intronic
1081789970 11:45775564-45775586 AGGCAAGCAGAAGAGGGGCTTGG - Intergenic
1082878990 11:58019722-58019744 AGGCAGGAACCAGTGGGGCCTGG + Intergenic
1083189049 11:61036407-61036429 AGGCCATGAGCAGTGGGGCAGGG - Intergenic
1083306854 11:61765945-61765967 AGGGAAGCAGCTGCGGGGAAGGG - Exonic
1083882454 11:65555291-65555313 AGGGAAGGAGCAGAGGGGGATGG - Intronic
1083924973 11:65800582-65800604 AGGCACCCATCAGTGGTGCAGGG + Intergenic
1083949442 11:65945941-65945963 AGGGAGGCAGGAGTGGGACAGGG + Intronic
1084026941 11:66456556-66456578 AGAAAAGCAGAAGTGGGGCCGGG + Intronic
1084133885 11:67160077-67160099 AGGGAAGAGGCAGTGAGGCAGGG - Intronic
1084878722 11:72154300-72154322 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1085417101 11:76326361-76326383 AGGGAAGCAGACGTGGGCCAGGG - Intergenic
1085621569 11:78041702-78041724 TGGCAAACAGCAGTGGTGGATGG - Intronic
1088173236 11:107019523-107019545 AGGCAAGGGGCAGTGGGGTCAGG - Intergenic
1088235805 11:107721450-107721472 AGGCAAGCAGTGGTGGTGCTTGG - Intergenic
1088879797 11:113964486-113964508 CGGCAAACAGCAGTGGGGGATGG - Intergenic
1088973825 11:114797060-114797082 AGGCAGGAAGCAATGGGTCATGG + Intergenic
1089331518 11:117692190-117692212 GGCCAAGCAGCAGGGAGGCAAGG - Intronic
1090066323 11:123506843-123506865 AGGCAGGGAACAGTGGGGCTGGG - Intergenic
1091345216 11:134847717-134847739 AGGCCTGCAGCAGTGAGGCCTGG - Intergenic
1091364019 11:135001867-135001889 TGGCTGGCAGCAGTGGGACAGGG - Intergenic
1091715532 12:2773684-2773706 AGGCAAGCAGGAGGAGGTCAGGG - Intergenic
1092074649 12:5663109-5663131 AGGCAGGCATGTGTGGGGCATGG - Intronic
1092291739 12:7163449-7163471 AGGCAAGAAGCAGTGAAGCGGGG + Intergenic
1092857270 12:12685713-12685735 AGGAAAGAAGCAGTGGAGGATGG - Intronic
1093106666 12:15095461-15095483 TGGCAAACAGCAGTGGTGGACGG + Intergenic
1094487602 12:30937438-30937460 CGGCAGGGGGCAGTGGGGCAGGG + Intronic
1094640992 12:32275642-32275664 TGGCAAACAGCAGTGGTGGACGG - Intronic
1094821625 12:34230736-34230758 AGCCAAGAAGCAGATGGGCAGGG + Intergenic
1096070688 12:48773943-48773965 AGGAAAGCTGCAGGTGGGCATGG + Exonic
1096077683 12:48815309-48815331 AGGGAAGAAGCAGAGCGGCAGGG + Intronic
1096096123 12:48936930-48936952 AGGGAAGCATCTGTGGGGCCAGG + Exonic
1096351238 12:50902861-50902883 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1096505364 12:52089086-52089108 AAGCAGGCAGCACAGGGGCAGGG - Intergenic
1096773984 12:53953123-53953145 AGGCAAGCAGGGGCGGGGAAGGG + Intergenic
1097819780 12:64116926-64116948 AGGAAGGCATCAGTGAGGCAGGG + Intronic
1100335069 12:93621433-93621455 AGTCATGAAGAAGTGGGGCAGGG - Intergenic
1100340432 12:93674400-93674422 AGGGCAGCAGCCGAGGGGCATGG - Intergenic
1100852087 12:98722775-98722797 AGGCCAGCTTCAGTGGGGCCAGG + Intronic
1101662168 12:106775128-106775150 ATGCATCCAGGAGTGGGGCACGG - Intronic
1101740347 12:107495350-107495372 AGGCAGGCAGCAGTGGGGCTTGG + Intronic
1101879176 12:108614762-108614784 AGGGCAGGAGCCGTGGGGCATGG + Intergenic
1102536735 12:113587243-113587265 AGGCAGCCAGCAGTTGGGGAGGG + Intergenic
1102849649 12:116228472-116228494 AGAAAAGCAGTAGTTGGGCATGG - Intronic
1103504241 12:121430538-121430560 AGGCACTCAGCAGTGGGGACAGG + Intronic
1103781062 12:123399106-123399128 TGGCAGCCAGCAGCGGGGCAGGG + Intronic
1103872345 12:124100842-124100864 CGGCAATCAGCAGTGGTGGATGG + Intronic
1103948194 12:124538568-124538590 ACGCAAGCTGCAGAGGGGCAAGG + Intronic
1104069339 12:125330962-125330984 TGGAAAGCAGCAGTGGGCCTTGG + Intronic
1104112107 12:125713948-125713970 AGGCCAGCAGGAATGGGCCATGG - Intergenic
1104187869 12:126449674-126449696 CGGCCAGCAGCAGTGGTGGACGG + Intergenic
1104850971 12:131873564-131873586 CAGCAAGCAGCAGTGGTGGATGG + Intergenic
1104860335 12:131920146-131920168 AGACAGACACCAGTGGGGCAGGG + Intronic
1105830482 13:24160150-24160172 AGGCAGTGGGCAGTGGGGCACGG + Intronic
1107409161 13:40142447-40142469 AGGCAAGATGAAGTGAGGCAGGG - Intergenic
1108876192 13:55054003-55054025 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1108877212 13:55061318-55061340 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1109352475 13:61202393-61202415 AGGCAAACAACTTTGGGGCAGGG - Intergenic
1109680720 13:65748471-65748493 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1109849656 13:68044658-68044680 ATGCAAGCAAGAGTGGGGAAGGG + Intergenic
1110660990 13:78059440-78059462 CGGCAAACAGCAGTGGTGCATGG - Intergenic
1110841287 13:80146539-80146561 AGGCAAGGAGGTTTGGGGCAGGG - Intergenic
1110846140 13:80192428-80192450 TGGCAACCAGCAGTGGTGGATGG - Intergenic
1111021439 13:82457681-82457703 AGGCAAACAGCAGTGGTGGATGG - Intergenic
1111820395 13:93206892-93206914 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1113100560 13:106713042-106713064 AGGCCAGCAGCCGTGGTCCAGGG - Intergenic
1113632773 13:111899378-111899400 AGGACGGCAGCAGTGGGGCGGGG - Intergenic
1113704265 13:112415801-112415823 AGGTAATCAGCAGTGAAGCAGGG + Intronic
1114383847 14:22236732-22236754 TGGCAAACAGCAGTGGTGGATGG - Intergenic
1115694374 14:35881030-35881052 AGCCAAGCTGCAGTGCAGCAGGG + Intronic
1116019380 14:39442013-39442035 TGGGAAGCAGCAGTGGGGCTGGG + Intergenic
1117171807 14:53108124-53108146 TGGCAAACAGCAGTGGTGGATGG - Intronic
1117202653 14:53408372-53408394 AGGGAGGCAGGAGTGGGGGAGGG - Intergenic
1117202675 14:53408429-53408451 AGGGAGGCAGGAGTGGGGGAGGG - Intergenic
1119089946 14:71772217-71772239 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1119623023 14:76147155-76147177 AAGCAGGCAGCAGTGGAGGAGGG - Intergenic
1119975881 14:79023436-79023458 AGGAAAGAAAGAGTGGGGCAGGG + Intronic
1120642636 14:87033497-87033519 AGGCATGCAGGAGTGGTGCTGGG + Intergenic
1121313385 14:92947026-92947048 AGGCCAGCAGCTGCGGGACATGG + Intronic
1122144032 14:99678205-99678227 AGGTGAGTGGCAGTGGGGCAGGG - Exonic
1122157551 14:99759293-99759315 AGGCATGCTGCAGTCAGGCAGGG + Intronic
1122250908 14:100439042-100439064 AGGCAAGGAGCAGTAGGGAGTGG + Intronic
1122508922 14:102250324-102250346 TGGCAAGGAGCAGTGGCCCAGGG - Intronic
1122536317 14:102466015-102466037 GTGGAGGCAGCAGTGGGGCAGGG + Intronic
1122710986 14:103658006-103658028 AGCCAAGCTACAGAGGGGCAAGG - Intronic
1123125452 14:105942865-105942887 GGGCAAACAGCAGTGGTGGACGG - Intergenic
1123449626 15:20351669-20351691 GGGCAGGGAGCAGAGGGGCAGGG + Intergenic
1123790172 15:23711821-23711843 AGGCAAGGAGGAGTGGTGGAAGG + Intergenic
1125062676 15:35442859-35442881 AAGCTGGGAGCAGTGGGGCAGGG + Intronic
1125532754 15:40424265-40424287 AGGGAAGCAGCAGAAGGGGAAGG - Intronic
1126103472 15:45133620-45133642 AGCCAAAAAGCAGTGGAGCAGGG - Intronic
1126486281 15:49185115-49185137 AGGAAAGGAGGAGTGGGGTATGG - Intronic
1126814204 15:52438858-52438880 TGGCAAACAGCAGTGGTGGACGG - Intronic
1127294247 15:57595908-57595930 AGTCAGGCAGCAATGGGACATGG - Intronic
1128310792 15:66630811-66630833 ATGCAAGGGGCAGTGTGGCAGGG + Intronic
1128363113 15:66976484-66976506 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1129187395 15:73918096-73918118 AGGCGATCAGGAGTGAGGCATGG + Intergenic
1129189696 15:73930182-73930204 AGGCAAGCATTGGTGGGGCCAGG + Intronic
1129244371 15:74270709-74270731 AGGCTGGCAGCAGAGGCGCATGG + Intronic
1129312356 15:74721530-74721552 AGGCAGGCAGCAGCAGGTCAGGG + Intronic
1129385027 15:75191679-75191701 AAGCCAGCAGCAGTGGCACAGGG - Intergenic
1129685420 15:77683708-77683730 AGGCCAACAGCAGTGGGACATGG + Intronic
1129776379 15:78239329-78239351 CGGCAAACAGCAGTGGTGGACGG + Intronic
1130841008 15:87701304-87701326 GGGCTTGCAGCAGTGGGGCTGGG - Intergenic
1130915318 15:88300190-88300212 ATGCATGCTGCAGTGGGGGATGG - Intergenic
1131673844 15:94651138-94651160 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1132094380 15:98971005-98971027 TGGCCAGAGGCAGTGGGGCATGG - Intronic
1132424200 15:101700385-101700407 AGGGAAGCATCAGTGGCCCATGG + Intronic
1133294655 16:4745465-4745487 AGGCAAGCTGCAGTGAAGCTGGG + Intronic
1133486272 16:6222412-6222434 AGGCAAGCAGAAGGAGGGAAGGG - Intronic
1134000551 16:10779550-10779572 AGGCAAACAGCACAGGGGCATGG + Intronic
1135013317 16:18903361-18903383 AGAAAAGGAGCACTGGGGCATGG - Intronic
1135320248 16:21490957-21490979 AGAAAAGGAGCATTGGGGCATGG - Intergenic
1135373083 16:21922447-21922469 AGAAAAGGAGCATTGGGGCATGG - Intergenic
1135438706 16:22448255-22448277 AGAAAAGGAGCATTGGGGCATGG + Intergenic
1135640817 16:24118476-24118498 AGCTACCCAGCAGTGGGGCAGGG - Intronic
1135800391 16:25488912-25488934 ATGCAGGCAGCAATGGGGAAGGG + Intergenic
1136330473 16:29572655-29572677 AGAAAAGGAGCATTGGGGCATGG - Intergenic
1136445103 16:30312375-30312397 AGAAAAGGAGCATTGGGGCATGG - Intergenic
1136537945 16:30911291-30911313 AGCCTTGCAGCAGAGGGGCAGGG + Intergenic
1137783381 16:51116333-51116355 AGACAACAAGCAGTGGGGGAGGG - Intergenic
1138036299 16:53610057-53610079 AGGCAAGGAGAAGTGGGCAATGG + Intronic
1138643651 16:58406764-58406786 CTGCCAGGAGCAGTGGGGCAAGG + Intergenic
1140982988 16:80128406-80128428 AGGGAAGCAGGACTGGGGTAGGG + Intergenic
1141441556 16:84032750-84032772 AGGCAGGCAGCAGAGGGAGATGG + Intronic
1141699680 16:85636661-85636683 GGCCCAGCAGCAGTGGGACACGG - Intronic
1142173822 16:88635845-88635867 AGGGCGGCGGCAGTGGGGCAGGG - Intergenic
1142218033 16:88839420-88839442 CCGAAAGCAGCAGTGGGGCCTGG + Intronic
1142278320 16:89134499-89134521 CGGCAAGCAGCAGTGGTGGACGG + Intronic
1142697103 17:1639791-1639813 AGGCAGGCAGGAGACGGGCAGGG + Intronic
1142764795 17:2058980-2059002 AGGCACGAAGCAGTGAGGCCAGG - Exonic
1142982151 17:3678563-3678585 GGGGCTGCAGCAGTGGGGCAAGG - Intronic
1143238242 17:5421351-5421373 AGGCTGGAAGCAGTGGGCCAGGG + Exonic
1144727615 17:17509769-17509791 AGAAGAGGAGCAGTGGGGCAGGG - Intronic
1145823100 17:27855538-27855560 AGGGAGGCTGCAGTGGGGCTGGG + Intronic
1147522706 17:41189885-41189907 AGGGGAACAGCAGTGGGTCATGG - Exonic
1147524824 17:41212704-41212726 AGGGGAGCAGCAGTGGGTCATGG - Intronic
1147526242 17:41226653-41226675 AGGGGAGCAACAGTGGGTCATGG - Exonic
1147526780 17:41232500-41232522 AGGGGAGCAACAGTGGGTCATGG - Exonic
1147528406 17:41249719-41249741 AGGGGAGCAACAGTGGGTCATGG - Exonic
1147528928 17:41255384-41255406 AGGGGAGCAACAGTGGGTCATGG - Exonic
1147530416 17:41271309-41271331 AGGGGAACAGCAGTGGGTCATGG - Intergenic
1147530829 17:41275696-41275718 AGGGGAGCAACAGTGGGTCATGG - Exonic
1147637754 17:41974325-41974347 AGGCAAAAGGCAGTGGGGCTGGG + Exonic
1147968682 17:44207830-44207852 AGCAGAGCAGCAGTGGGGTAGGG - Intronic
1148262280 17:46193690-46193712 CGGCACGCAGCACTGCGGCAGGG + Intronic
1149243112 17:54673775-54673797 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1149623629 17:58064346-58064368 GGGCATGCAGAAGTGGGTCAAGG + Intergenic
1149648120 17:58255087-58255109 AGAGAAGCAGCAGAGGGGCCGGG - Intronic
1150179005 17:63095098-63095120 AGAGAAGCATCAGTGGGGCAGGG - Intronic
1150225647 17:63523226-63523248 AGGAAAGGAGAGGTGGGGCAGGG + Intergenic
1151224445 17:72638348-72638370 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1151457078 17:74232650-74232672 AGGCAGGCAGCAGGATGGCAGGG - Intronic
1151527427 17:74680625-74680647 AGGGAGGCAGAGGTGGGGCAAGG - Intronic
1151732124 17:75917812-75917834 GGGCCAGCAGCAGCGGGACATGG - Exonic
1152217791 17:79044495-79044517 AGGCAGGGAGAAGTGGAGCATGG + Intronic
1152371838 17:79893077-79893099 AGGCCAGCAGCAGTGGGGGCAGG + Intergenic
1152730373 17:81967041-81967063 AGGCCAGCAGCTGGGGCGCAGGG - Intergenic
1152791873 17:82284479-82284501 AGGCAGAAAGCAGTGGGGGAGGG + Intergenic
1153402050 18:4692000-4692022 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1153820902 18:8830519-8830541 AGGGGAGCAGCAGCGGGGGAAGG - Intronic
1155557310 18:27034019-27034041 AGGGAAGCAGCAGTGCGGATGGG - Intronic
1156994235 18:43447285-43447307 TGGCAAGGGGCAGTGGGGCCAGG - Intergenic
1157259332 18:46165103-46165125 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158018220 18:52809650-52809672 CGGCAAACAGCAGTGGGGGACGG + Intronic
1158152293 18:54386967-54386989 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1158917608 18:62151205-62151227 AGACAGGCATGAGTGGGGCAAGG + Intronic
1159524380 18:69568654-69568676 AGGTGAGCAGCAGTGGGCAAGGG + Intronic
1160672755 19:374029-374051 GGGCAAGAGGCAGTGGGGCTCGG - Intronic
1160733715 19:652440-652462 AGGGAAGCAGCAGCGGGTTACGG - Intronic
1160887547 19:1357887-1357909 AGGCAGGAGGGAGTGGGGCAGGG - Intronic
1161242455 19:3229882-3229904 AGGAAAGGAGCAGAGGGGCTTGG + Intronic
1161575540 19:5052532-5052554 AGGCGGGCAGCAGAGGGGTAAGG - Intronic
1161655869 19:5514541-5514563 AGGCAAGGATTTGTGGGGCAAGG + Intergenic
1162079103 19:8208532-8208554 AGGGCAGCAGCAGTGGGGGCTGG - Intronic
1162201409 19:9023310-9023332 AGAAAAGCAGGAGTGGGGCAGGG + Intergenic
1163679876 19:18675062-18675084 AGGCAAGAACCCGTGGAGCAGGG - Intergenic
1164015462 19:21252844-21252866 ATACAAGAATCAGTGGGGCATGG + Intronic
1165126568 19:33602130-33602152 AGCCAAGCAGAGATGGGGCAGGG - Intergenic
1165159088 19:33805421-33805443 GTGCAAGTGGCAGTGGGGCAGGG + Intronic
1165896748 19:39145960-39145982 AGGCCAACAGAGGTGGGGCAGGG - Intronic
1166338380 19:42122482-42122504 GGGCAGGGAGCAGGGGGGCAGGG - Intronic
1167790758 19:51678129-51678151 GGACAAGCAGCAGTGGGAAACGG - Intergenic
1168147019 19:54425248-54425270 CGGCAAACAGCAGTGGTGGACGG + Intronic
925241411 2:2333423-2333445 AGGCAAGCAGCATGTGGGTAAGG + Intergenic
925351425 2:3203688-3203710 AGGCCAGCCGCTCTGGGGCAGGG - Intronic
925479215 2:4251389-4251411 AGGCCAGAAGCACTGGGGAAAGG - Intergenic
925574215 2:5343836-5343858 AGGCAAGCATCACTGAGGAACGG - Intergenic
926128212 2:10284780-10284802 ATGCAGGCAGCAGGTGGGCAGGG - Intergenic
926344738 2:11934981-11935003 AGGGTAGCAGCAGTGTGGTAGGG + Intergenic
928124888 2:28608407-28608429 AGGCAAGACGCAGTGGGGGGCGG + Intronic
928440099 2:31285090-31285112 CGGCAATCAGCAGTGGTGGACGG - Intergenic
929542353 2:42832094-42832116 CGGCAAACAGCAGTGGTGGACGG - Intergenic
929960678 2:46494040-46494062 AGACAAAGAGCAGTGGGGCCTGG + Intronic
931005947 2:57850224-57850246 AGGAGAGCAGCAGTGGGGCTTGG - Intergenic
931038980 2:58275750-58275772 CGGCAAACAGCAGTGGTGGACGG - Intergenic
931651862 2:64475859-64475881 TAGCAAGCAGCAGTGGGGTGTGG - Intergenic
931652069 2:64477615-64477637 TGGCAAGCAGTAGTGGGGTGTGG + Intergenic
932464355 2:71906794-71906816 AGGAAACCTGCAGTGGGGAAAGG + Intergenic
932868743 2:75374871-75374893 GGGCAAGCTGAAGTAGGGCAGGG - Intergenic
932917171 2:75872053-75872075 CGGCAAACAGCAGTGGTGGATGG - Intergenic
934762522 2:96864445-96864467 GGGCAAGCAGCAGGAAGGCAGGG + Intronic
936329641 2:111536789-111536811 AGGCAGGTGGCACTGGGGCACGG - Intergenic
937868507 2:126771349-126771371 CAGGAGGCAGCAGTGGGGCAAGG + Intergenic
938221806 2:129575359-129575381 AGGCAAGGAGCAGCGGAGGAGGG - Intergenic
938314118 2:130314728-130314750 AGCCAAGCAGCAGTGGCCAAGGG + Intergenic
938691280 2:133791789-133791811 AAGCAAGGAGAACTGGGGCATGG + Intergenic
939134088 2:138273520-138273542 CGGCAAACAGCAGTGGTGGACGG + Intergenic
939801953 2:146721219-146721241 GGGAAAGCAGCAGTGGGACTGGG + Intergenic
940669037 2:156645140-156645162 TGGCAAACAGCAGTGGTGGATGG - Intergenic
941929117 2:170923633-170923655 TGGGAAGCAGCAGCGGGGCTGGG - Intergenic
942242159 2:173972594-173972616 AGGGCAGCAGAAGTGGGCCAGGG - Intergenic
942679484 2:178462535-178462557 TGGCAAACAGCAGTGGTGGACGG - Intergenic
944553886 2:200869264-200869286 AGGCATGCGGGAGTGGTGCAGGG - Intergenic
944913583 2:204334303-204334325 TGGCAAGGAGGAGTGGGCCAGGG - Intergenic
945204278 2:207315141-207315163 AGGGAAGAAGCAGTGGGGGCTGG + Intergenic
946152695 2:217787250-217787272 AGGCGTGCAGGTGTGGGGCACGG - Intergenic
946405511 2:219489938-219489960 AGGCAAGCAGGGCTGGGGAAGGG + Exonic
946474895 2:219997522-219997544 AGGCTGGCAGCACAGGGGCAGGG + Intergenic
1168953446 20:1818041-1818063 AGGAAGGCAGCAGAGGGGCCGGG + Intergenic
1169000905 20:2167373-2167395 AGGCAAGCTCCAGGGGAGCAGGG - Intronic
1169519702 20:6357635-6357657 AGGCAAGCAGCAGTAAGACAGGG + Intergenic
1170075404 20:12413242-12413264 TGGCAAGCAACAGTGGGTCGGGG + Intergenic
1170459409 20:16563224-16563246 AGGTAACCACCAGTGGGGCCAGG - Intronic
1170791114 20:19510377-19510399 CAGCACACAGCAGTGGGGCATGG - Intronic
1171500797 20:25591493-25591515 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1171992701 20:31708730-31708752 AGAGAAGGAGCTGTGGGGCAGGG + Intronic
1172015273 20:31869611-31869633 AGGCAAGGGTCAGTGGGGCAGGG + Intronic
1172328373 20:34055441-34055463 AAGGAAGCAGGGGTGGGGCATGG + Intronic
1172425449 20:34852465-34852487 AGACAGGCAGGAGTGGGGCAGGG + Exonic
1172947191 20:38698744-38698766 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1173342512 20:42165185-42165207 TGGCTGGTAGCAGTGGGGCAGGG - Intronic
1173527800 20:43746172-43746194 AAGCAAGGAGGAGTCGGGCACGG - Intergenic
1173895313 20:46546274-46546296 AGGCAGCCTGCAGTGGGGCAAGG + Exonic
1174079727 20:47962413-47962435 GGGCAGGGAGCAGTGGGGCCCGG + Intergenic
1174368271 20:50069381-50069403 AGGCAGGCAGCAGTGGGCAGGGG - Intergenic
1175461149 20:59152813-59152835 AGGCAACCAGAAGTGGGGCTTGG + Intergenic
1177359363 21:20048656-20048678 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1177895730 21:26854808-26854830 CGGCAAACAGCAGTGGTGGAAGG - Intergenic
1177896702 21:26861644-26861666 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1178761268 21:35405072-35405094 AGCCAAACAGAAGTGGGGCAGGG - Intronic
1179259613 21:39746277-39746299 TGGCAAACAGCAGTGGTGGACGG + Exonic
1179980122 21:44891351-44891373 AGGCTGGCAGCCCTGGGGCATGG - Intronic
1179996125 21:44975284-44975306 AGGGGAGCAGCCTTGGGGCACGG - Intronic
1180619719 22:17152929-17152951 AGCCAAGCAGGAGGAGGGCAGGG + Intronic
1180919888 22:19516226-19516248 AGCCAAGGGGCAGTGGGGCTAGG + Intronic
1181506275 22:23360381-23360403 AGGCACTCAGCAATGGGGCCTGG - Intergenic
1181557225 22:23678067-23678089 AGGGAAACAGCAGAGGGGCTGGG - Intergenic
1181697155 22:24599493-24599515 AGGGAAACAGCAGAGGGGCTGGG + Intronic
1181759897 22:25051095-25051117 AAGCAGGCAAGAGTGGGGCAGGG - Intronic
1181950514 22:26550508-26550530 AGAAAAGCGGCAGGGGGGCAGGG + Intronic
1183302568 22:37065511-37065533 TGGCAGGCAGGGGTGGGGCAAGG + Exonic
1183433782 22:37781810-37781832 AGGCAAGCAGGGCAGGGGCATGG - Intergenic
1183604462 22:38860414-38860436 AGGCAAGGAGGAGGGGGGCGGGG + Intergenic
1183638758 22:39080864-39080886 AGGAGAGCAGGGGTGGGGCAGGG - Intronic
1183664816 22:39241234-39241256 CGGCAGGCAGCCGTGAGGCAGGG - Intronic
1183724057 22:39578670-39578692 AGGCAGGGAGCAGTGGAGCAGGG - Intronic
1183736805 22:39648963-39648985 AGGCATGGAGCCCTGGGGCAAGG - Intronic
1183933556 22:41249340-41249362 ACGCCAGCAGCAGGGGTGCAAGG + Exonic
1184297718 22:43535869-43535891 AGGGAAGCAGCAGCAGGTCACGG + Intronic
1184308269 22:43624046-43624068 AGATAATGAGCAGTGGGGCAGGG - Intronic
1184393945 22:44221589-44221611 AGGAAAGAAGGTGTGGGGCAGGG + Intergenic
1184501902 22:44879503-44879525 AGGCAAGGAGGAGAGGAGCAGGG + Intergenic
1184948030 22:47818125-47818147 AGGGGAGCTCCAGTGGGGCAGGG - Intergenic
1185062531 22:48614548-48614570 AGGCAAGGAGCCCTGGGGGAGGG - Intronic
1185125294 22:49007149-49007171 AAGCAGACAGCCGTGGGGCAGGG + Intergenic
1185307364 22:50127489-50127511 AGGGAAGCAACAGTGGTACAGGG - Intronic
950052898 3:10005562-10005584 GGGCAAGAAGTGGTGGGGCATGG - Intronic
952675613 3:36026760-36026782 AGACACGCAGGAGTGGTGCAAGG + Intergenic
952934592 3:38386291-38386313 AGGCAAACAGAAGTGGCTCAAGG - Intronic
953699586 3:45185435-45185457 AGGAAGGGAGGAGTGGGGCATGG + Intergenic
953926363 3:46984652-46984674 AGACAAGCAGAAGTGGGACAGGG - Intronic
954420724 3:50417723-50417745 GGACAAGCAGCAGGGGGGCAAGG - Intronic
954897848 3:53992184-53992206 AGGTAAGCAGAAGTGTTGCATGG - Intergenic
955208453 3:56918503-56918525 GGGCAGGTAGCAGTGGAGCAGGG + Intronic
955381279 3:58440224-58440246 TGGCAAACAGCAGTGGTGGACGG + Intergenic
956352552 3:68353677-68353699 AGGCAGACAGCAGAGGAGCAAGG + Intronic
956380792 3:68662510-68662532 AGGCAGGCAGAACTGGGGAAAGG + Intergenic
956798973 3:72739769-72739791 AAGGAAACAGGAGTGGGGCAGGG + Intergenic
958586156 3:96091022-96091044 GGACAAGCAGAAGTGGGGCATGG + Intergenic
959651879 3:108758093-108758115 AGGAAGGAAGGAGTGGGGCAAGG + Intergenic
959905113 3:111702712-111702734 AGGCAAGGATCAGTGGTGCAGGG + Intronic
960006990 3:112790777-112790799 CGGCAAACAGCAGTGGTGGATGG + Intronic
961213859 3:125144779-125144801 ATCCAAGCAACAGTGGGGCAGGG - Intronic
961382456 3:126504762-126504784 AGGCAAGGAGCCTTGAGGCAAGG - Intronic
961429731 3:126872808-126872830 AGGGAAGGAGCAGCAGGGCAGGG - Intronic
961602986 3:128075505-128075527 GGGGAAGGAGCAGTGGGGGAAGG - Intronic
961677799 3:128578115-128578137 AGGCAAGCAGCCGTGGTGACAGG + Intergenic
961812643 3:129530766-129530788 AGGCAACCAGGAGTGGGAGAGGG - Intronic
961992012 3:131202268-131202290 AGGCAAGCTGAAGCAGGGCAGGG + Intronic
962763750 3:138542551-138542573 TGGGAAGCAGCTGTGGGGCCAGG - Intronic
963024086 3:140901144-140901166 TGGCAAACAGCAGTGGTGGATGG - Intergenic
964734412 3:159901571-159901593 AGAAAAGAAGCAGTGTGGCATGG - Intergenic
965342138 3:167503710-167503732 TGGCCAGCAGCAGTGGTGGAGGG + Intronic
965734418 3:171805575-171805597 AGGGTAGAAGCACTGGGGCAGGG - Intronic
966353265 3:179054718-179054740 CGGCAAGCAGCAGTGTTGGATGG - Intronic
966868689 3:184276400-184276422 AGGCAGGGAGCACTGGGGCAGGG + Intronic
967840913 3:194003796-194003818 AGGGAGGCCGCAGTGGGGCCTGG + Intergenic
969134605 4:5019921-5019943 AGGCAGCCCGCAGTGGAGCAGGG + Intergenic
969162615 4:5274794-5274816 CGGCAAACAGCAGTGGTGGACGG - Intronic
969348515 4:6584181-6584203 AGACAAGCATGAGTGGGGCAGGG - Intronic
969370437 4:6727878-6727900 AGGCAAGGAGGAGAGGGGGAGGG - Intergenic
970169423 4:13274989-13275011 AGGAGAGGAGAAGTGGGGCAAGG - Intergenic
970171770 4:13297668-13297690 ATCCAAGCAGCAGTGAGGGAAGG + Intergenic
970738116 4:19198142-19198164 CCGCAAACAGCAGTGGTGCACGG + Intergenic
971680922 4:29699680-29699702 AGCCAAGAAGCAGGGTGGCAGGG + Intergenic
971869124 4:32213077-32213099 AGGCAAGCAGCATAGTGGCTAGG - Intergenic
972075350 4:35079805-35079827 TGGGAAGCAGTAGTGGGGCCGGG + Intergenic
972766775 4:42158571-42158593 CGGCAAACAGCAGTGGTGGACGG + Intergenic
972853836 4:43082217-43082239 GGGCAAACAGCAGTGGTGGACGG - Intergenic
974093361 4:57335486-57335508 AGCCCAACATCAGTGGGGCAGGG + Intergenic
974657986 4:64849559-64849581 AAACATGCAGGAGTGGGGCAGGG - Intergenic
974873115 4:67668307-67668329 GGGACAGCAGCAGTGGGACAGGG - Intronic
975313230 4:72926028-72926050 CGGCAAACAGCAGTGGTGGACGG + Intergenic
975479266 4:74859714-74859736 GGGCAAGCAGAAGCAGGGCACGG + Intergenic
976129539 4:81870389-81870411 ATGCCAGCTGCAGTGGGGGAGGG + Intronic
977251317 4:94692625-94692647 CGGCAAACAGCAGTGGTGGACGG - Intergenic
977556174 4:98489576-98489598 CGGCAATCAGCAGTGGTGGACGG - Intronic
978587031 4:110284303-110284325 TGGCAAACAGCAGTGGTGGACGG + Intergenic
979193318 4:117890202-117890224 GGCCAAGCAGCTGTGGTGCATGG + Intergenic
979266822 4:118713091-118713113 AATCAAGCAGGAGTGTGGCATGG + Exonic
979822230 4:125189219-125189241 TTGGAAGCAGCAGTGTGGCAGGG - Intergenic
979910827 4:126363671-126363693 TGGCAAACAGCAGTGGTGGATGG - Intergenic
980326408 4:131352806-131352828 AGGCAGGCAGCAGTGAGGCTGGG + Intergenic
980625711 4:135372297-135372319 CGGCAAACAGCAGTGGTGGATGG - Intergenic
980790429 4:137613267-137613289 CGTCAAGCAGCAGTGGTGGATGG - Intergenic
980871972 4:138622139-138622161 TGGCAAACAGCAGTGGTGCATGG + Intergenic
981144155 4:141305299-141305321 AGGCAAGAGGCAGTGGGGCATGG + Intergenic
982106946 4:152019609-152019631 AGACAAGCAGCTGTGGGCAAAGG + Intergenic
982336473 4:154244892-154244914 GGGCAAGCAGCAGGGGAGAAAGG - Intronic
982978783 4:162104067-162104089 TGGCAAACAGCAGTGGTGGACGG - Intronic
983261542 4:165462169-165462191 AGTAAAGCAGCAGTAGGGAATGG + Intronic
983310427 4:166053420-166053442 ATGCAAGCACCAGGAGGGCAAGG + Intronic
983667444 4:170196968-170196990 CGGCAAACAGCAGTGGTGGATGG + Intergenic
984064649 4:175033108-175033130 TGGGAAGTAGCAGTGGGGCTAGG - Intergenic
984067750 4:175070100-175070122 ATGCAAGCAGAGATGGGGCAAGG + Intergenic
984850178 4:184145743-184145765 AGTCAAGCTGCAGTGGCTCAGGG - Intronic
985115895 4:186590291-186590313 AGTCAGTCAGCACTGGGGCAAGG + Intronic
985809933 5:2075491-2075513 AGGACAGCAGCTGTGGAGCAGGG + Intergenic
986076421 5:4342428-4342450 AGGCAGGCAGCAGTGGGCTCTGG + Intergenic
987080341 5:14420020-14420042 AGGTAGGAATCAGTGGGGCATGG + Exonic
987175659 5:15305850-15305872 AGGGATGCAGGAGTGAGGCAAGG - Intergenic
987905347 5:24069366-24069388 TGGCAAACAGCAGTGGTGGACGG - Intronic
988520899 5:31944863-31944885 AGGCAAGCAGCTGCTGCGCACGG - Intronic
988563437 5:32301124-32301146 AGGCAAGCTGGGGTGGGGCTGGG + Intronic
988657546 5:33228818-33228840 AGGCAAGCAGAAGTGGGAACAGG - Intergenic
988740545 5:34064672-34064694 CGGCAAACAGCAGTGGTGGATGG + Intronic
988957400 5:36332981-36333003 CGGCAAACAGCAGTGGTGGATGG + Intergenic
989688426 5:44114670-44114692 TGGCAAACAGCAGTGGTGGATGG - Intergenic
990275668 5:54193426-54193448 AGGTAAGCAGCAGGTGAGCAAGG + Intronic
991258958 5:64646201-64646223 AGGAAAGAAGCATGGGGGCAGGG + Intergenic
991972378 5:72153499-72153521 AGACAAGCAGAAGTGAGGCCTGG + Intronic
991994171 5:72370915-72370937 AGTCAAGTTGCATTGGGGCACGG + Intergenic
992293493 5:75304574-75304596 CGGCAAACAGCAGTGGTGGATGG - Intergenic
992515758 5:77491246-77491268 TGGCGGGCAGGAGTGGGGCAAGG - Intronic
992586260 5:78243508-78243530 AGGTAAGCAGCACATGGGCAAGG - Intronic
992742944 5:79792064-79792086 AGGCAAGTAGCAATGTGACAGGG - Intronic
993225633 5:85165289-85165311 TGGCAAACAGCAGTGGTGGACGG - Intergenic
993810595 5:92470964-92470986 GGGCAGGTAGAAGTGGGGCAGGG + Intergenic
993941859 5:94068393-94068415 TGGCAAACAGCAGTGGTGGATGG + Intronic
994094297 5:95835043-95835065 GTGCAGGCAGCAGTGGGACATGG - Intergenic
994678360 5:102854056-102854078 TTGCCAGCAGTAGTGGGGCAGGG - Intronic
995465163 5:112444070-112444092 TGGCAAACAGCAGTGGTGGACGG - Intergenic
995515595 5:112951672-112951694 AGGCGAGCAGCACTGTGCCAGGG + Intergenic
995541936 5:113194217-113194239 AGGCATCCAGCAGGGGGACATGG + Intronic
995859099 5:116623168-116623190 GGGCAGGCAGGAGAGGGGCATGG - Intergenic
996019247 5:118573683-118573705 AGGAAAACGGCAGTGGGGGAAGG - Intergenic
998813681 5:145991457-145991479 AAGCAGGAAGCAGTGGAGCAAGG - Intronic
998873659 5:146577293-146577315 AGGGATGGAGCAGTGGGGCTGGG - Intergenic
998939201 5:147262203-147262225 AGGCAAACAGAAGTGGGGTGAGG - Intronic
1000854378 5:166379948-166379970 AGGCAGGCTGCAGCGGGGAAGGG - Intergenic
1000908496 5:166993028-166993050 ATGCAAGCAGGAGTGGGGGAGGG - Intergenic
1001281773 5:170391206-170391228 AGGGAAGCAGGAGGGGGGCCTGG - Intronic
1001796811 5:174509265-174509287 ATGCAAGCAGAAGTGTTGCAAGG - Intergenic
1002673140 5:180886388-180886410 GGGCAAGCTGAAGTAGGGCAGGG - Intergenic
1003839353 6:10104282-10104304 AGACACTCAGCAGTGGTGCAGGG - Intronic
1004443200 6:15673089-15673111 AGGCAAGCAGAAGGAGAGCAAGG - Intergenic
1005324148 6:24682705-24682727 CGGCAAACAGCAGTGGTGGATGG + Intronic
1006152193 6:31995553-31995575 GGGCAAGCAGGAGGGGGGCCAGG + Intronic
1006158495 6:32028291-32028313 GGGCAAGCAGGAGGGGGGCCAGG + Intronic
1006417585 6:33913698-33913720 ATGGAGGCAGGAGTGGGGCAGGG + Intergenic
1007601350 6:43083594-43083616 ACACAGACAGCAGTGGGGCAGGG + Intronic
1007685728 6:43666287-43666309 AGGCAGGCAGCAGCTGGGCTGGG + Intronic
1008538332 6:52525137-52525159 AGCTAGGCAGCAGTGGGGCCAGG + Intronic
1008582777 6:52921518-52921540 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1008928708 6:56914549-56914571 AGGGAAGCAGGATTGGGCCACGG - Intronic
1009544321 6:65005109-65005131 TGGCAAACAGCAGTGGTGGACGG - Intronic
1009823743 6:68839853-68839875 ATGGCAGCTGCAGTGGGGCATGG + Intronic
1010456099 6:76057358-76057380 AGGCATGTAGCAGTGGGGACCGG + Intronic
1011702954 6:89972306-89972328 AGGCAAGCACCACTGTGGCCGGG + Intronic
1011729898 6:90250601-90250623 ATGCAAGCACCATTGGGGCAGGG - Intronic
1012734542 6:102921703-102921725 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1013021753 6:106228254-106228276 CGGCAAACAGCAGTGGTGGATGG - Intronic
1013438484 6:110138141-110138163 ATGCTGGCTGCAGTGGGGCAGGG + Intronic
1014208910 6:118687752-118687774 CGGCAAACAGCAGTGGTGGACGG - Intronic
1014278761 6:119417814-119417836 GGGCAAGCAGAAGCAGGGCAGGG + Intergenic
1015142367 6:129949665-129949687 AAGCAAGCATCACAGGGGCAAGG - Intergenic
1015288528 6:131511295-131511317 AGACAAGCAGAAGAGTGGCAAGG + Intergenic
1016265879 6:142232311-142232333 GGGCAAGCTGAAGTAGGGCAGGG + Intergenic
1016444928 6:144121424-144121446 TGGCAAACAGCAGTGGTGGATGG + Intergenic
1017372938 6:153735132-153735154 CAGGAAGCAGCAGTGGGGCCAGG - Intergenic
1017713096 6:157187232-157187254 AGGCTGGGAGAAGTGGGGCAGGG + Intronic
1017867046 6:158453122-158453144 AGGCAAGCAGCAGTAGCGCACGG - Intronic
1018783470 6:167090119-167090141 AGTCAAGGAGCTGTGGGCCAGGG + Intergenic
1019261503 7:84411-84433 AGGCAGGCAGCTCTGGTGCAGGG + Intergenic
1019268720 7:133926-133948 AGGGAAGCAGGAGTGGGGTTAGG + Intergenic
1019451485 7:1100934-1100956 AGGCCAGGAGCAGGGGTGCACGG - Intronic
1021885344 7:25131953-25131975 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1022117652 7:27276465-27276487 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1022639920 7:32172530-32172552 AGTCAAGAAGCAGTCAGGCATGG + Intronic
1022643957 7:32213621-32213643 AGGCAAGCAGCAGTGTTTGAGGG - Intronic
1022728904 7:33004725-33004747 ATGCAAGCATCACAGGGGCAGGG + Intronic
1023310941 7:38886175-38886197 GGGCAAGCAGAAGCAGGGCAGGG + Intronic
1023862647 7:44225463-44225485 AGGCAAGCAGCTGAGGGGAGAGG - Intronic
1023972561 7:45001995-45002017 AGACAAGGAGCTTTGGGGCATGG + Intronic
1024156766 7:46633986-46634008 AGGCAATGAGCAGTGGAGGAAGG - Intergenic
1024167663 7:46750684-46750706 ATGCACGATGCAGTGGGGCATGG + Intronic
1025035673 7:55591333-55591355 AGGGAGGCAGCAGTGGGGTGGGG - Intergenic
1025044743 7:55683265-55683287 ATGCAAGCATCACAGGGGCAGGG - Intergenic
1026524683 7:71143742-71143764 TGGAATGCAGCAGTAGGGCAGGG + Intronic
1026628777 7:72019567-72019589 ACTCAAGCAGCATTGTGGCAAGG + Intronic
1026713897 7:72769092-72769114 GGGCATGCAGCAGTTTGGCATGG + Intronic
1027188282 7:75984384-75984406 CGGCAAGCAGGGGTGGGGCGAGG - Intronic
1027591857 7:80128191-80128213 GGGCAAACAACACTGGGGCAGGG + Intergenic
1028013983 7:85684105-85684127 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1028041392 7:86058715-86058737 TGGCAAGGAGCAGTGGGGGTGGG + Intergenic
1028587731 7:92468311-92468333 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1028589093 7:92477798-92477820 TGGCAAACAGCAGTGGTGGACGG + Intronic
1028836098 7:95376920-95376942 GGGCAAGCCAAAGTGGGGCAGGG + Intronic
1028886079 7:95934724-95934746 AGGCAAGGAGAAGTCAGGCAGGG - Intronic
1028933386 7:96439448-96439470 AGGAAAGAAGAAGAGGGGCAAGG + Intergenic
1028993385 7:97074790-97074812 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1029131609 7:98335693-98335715 AGGCAGGCAGCAGTGGCACAGGG + Intronic
1029264208 7:99325775-99325797 AGGCAGGCTGCAGTGGAGGAGGG - Intergenic
1030336804 7:108337404-108337426 TGGCAAACAGCAGTGGTGGATGG - Intronic
1030532402 7:110727613-110727635 AGGAAACCTGCAGTGGGGAAAGG - Intronic
1030626255 7:111849035-111849057 AGGCAAGCAGCTCTAGGGCCCGG - Intronic
1030843985 7:114386161-114386183 TGGCAAACAGCAGTGGTGGATGG + Intronic
1031141289 7:117946387-117946409 AGGAAAGAAGGAGTGAGGCAGGG + Intergenic
1031250879 7:119378956-119378978 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1031299569 7:120047464-120047486 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1031828572 7:126598067-126598089 AGGCAGGGAGGAGTGGGGGAGGG - Intronic
1032087134 7:128890447-128890469 TGGCAGGCAGCAGTGGGCGATGG + Exonic
1032546739 7:132750271-132750293 ATGCAAGCAGCTGTTGGGCCAGG - Intergenic
1032649075 7:133857938-133857960 CGGGAAGCAGCAATGGGGCCAGG - Intronic
1033607561 7:142938508-142938530 AGAGAAGCCGCAGTGCGGCAGGG - Intergenic
1033726462 7:144123711-144123733 AGGCAGTTAGCAGAGGGGCAAGG - Intergenic
1033981173 7:147167471-147167493 TGGCAACCTCCAGTGGGGCAGGG - Intronic
1034248764 7:149671695-149671717 CGGCAAACAGCAGTGGTGGACGG - Intergenic
1034249490 7:149676815-149676837 CGGCAAACAGCAGTGGTGGATGG - Intergenic
1034292118 7:149941128-149941150 AACCCAGCAACAGTGGGGCAAGG + Intergenic
1034650848 7:152688867-152688889 CGGCAAACAGCAGTGGTGGACGG + Intergenic
1034651076 7:152690741-152690763 AGGAAAGCAGAAATGGGGAAGGG + Intergenic
1034813955 7:154155769-154155791 AACCCAGCAACAGTGGGGCAAGG - Intronic
1034918312 7:155059063-155059085 AAGCAGGCAGCAGGGGGGCCTGG - Intergenic
1034965015 7:155385412-155385434 CGGCAAACAGCAGTGGTGGACGG + Intronic
1035418345 7:158707411-158707433 TGGGAAGCAGCGGTGGGGCCGGG - Intergenic
1036459733 8:8941242-8941264 AGGGAAGCAGCAGTGGCGGGCGG + Intergenic
1037253102 8:16920006-16920028 CGGCAGGCACCAGTGGGGCTGGG + Intergenic
1038122217 8:24630070-24630092 AGCCAAGAAACAATGGGGCATGG - Intergenic
1038152339 8:24953870-24953892 AGGCAAGCAGGAGCAGGGCTGGG + Intronic
1039203464 8:35123008-35123030 AGACATGCAGGAGTGGTGCAGGG + Intergenic
1039604321 8:38868084-38868106 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1039819963 8:41126480-41126502 GGCCATGAAGCAGTGGGGCAGGG + Intergenic
1039831717 8:41220822-41220844 AGGCAAGCAGCAGCAGGGCCTGG - Intergenic
1040891933 8:52326254-52326276 TGGCCTGCAGCAGTGGGGAAGGG + Intronic
1041724763 8:61007830-61007852 AGGGAAGGAGCAGTGTGGCAGGG + Intergenic
1041953878 8:63536272-63536294 CGGGAAGCTGCAGTGGGGAATGG + Intergenic
1042054930 8:64754578-64754600 AGGCAAGCAGTAGGGAGGGAGGG + Intronic
1042055652 8:64763075-64763097 TGGCAAACAGCAGTGGTGGACGG - Intronic
1043370016 8:79580137-79580159 AGGGAGGCTGCAGTGGAGCAGGG + Intergenic
1043603544 8:81971329-81971351 TGGCAAACAGCAGTGGGGGTGGG + Intergenic
1044378118 8:91500107-91500129 AGGCAAGCAGAAGCAGGGCAGGG - Intergenic
1044532560 8:93324328-93324350 ATGCAGGCAGTAGAGGGGCAGGG - Intergenic
1044609558 8:94078564-94078586 ATGCTAGCAGCAGTGGCCCAGGG + Intergenic
1045657587 8:104403114-104403136 TGGCAAACAGCAGTGGTGGACGG - Intronic
1045788640 8:105955560-105955582 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1046503885 8:115112062-115112084 ATGCCAGCTGCAGTGGGGGAAGG - Intergenic
1047256613 8:123218045-123218067 AGGCGAGCAGCAGTGAAGGATGG + Intergenic
1047925191 8:129675923-129675945 TTGAAAGCAGCAGTGGGGAACGG - Intergenic
1048861697 8:138728591-138728613 TAGCAAGCAGCAGCAGGGCAAGG - Intronic
1049568480 8:143356204-143356226 TGGCAAGCAGCCGTGGGCCGGGG - Intronic
1049600949 8:143507275-143507297 AGGCAGCCAGCAGCAGGGCAAGG + Intronic
1049643502 8:143726008-143726030 AGGCCAGCAGCCCTGGGGCAGGG - Exonic
1049820320 8:144629472-144629494 AGGCCAGCAGGAGTGGGGCTGGG + Intergenic
1050067598 9:1777001-1777023 TGGCAACCAGCAGTGGGAGATGG - Intergenic
1050257035 9:3805146-3805168 AGGCAAGTAGCAGTAGAGTATGG - Intergenic
1051160224 9:14199307-14199329 TGGCAGGCAGTAGTGCGGCAGGG + Intronic
1051612141 9:18971282-18971304 AGGCAAGCAGCAGTGGGGCATGG - Intronic
1052365093 9:27603336-27603358 AGGCATGCAGGAGGGGTGCAGGG - Intergenic
1052437225 9:28444380-28444402 ACAGAAGCAGCAGTGGGGCTGGG + Intronic
1052965255 9:34335846-34335868 AGGAAAGCAGCGGTGGGGTGGGG - Intronic
1053101697 9:35376889-35376911 AGGCCAGCAGGAGGGGAGCAAGG - Intronic
1053134339 9:35640685-35640707 TGGCAAACAGCAGTGGTGGACGG + Intronic
1053456753 9:38238907-38238929 AGGTAAGCAGCAGAGTGACATGG - Intergenic
1055100575 9:72460514-72460536 AGGCAAGCAGCTGTGGGCAACGG - Intergenic
1055118909 9:72635660-72635682 AGGCAAGGAGCAGTGGGAATAGG + Intronic
1055253676 9:74339191-74339213 AGTTAAGCATGAGTGGGGCAGGG - Intergenic
1056667025 9:88589249-88589271 AGGCAACCAGCTGTGGGCAAGGG + Intergenic
1057020513 9:91693723-91693745 AGGGAACCAGGAGTGAGGCAGGG + Intronic
1057269934 9:93645021-93645043 GAGGAAGCAGCAGAGGGGCAGGG - Intronic
1057694793 9:97315482-97315504 AGGAAAGCAGCTGTGGGGAGGGG - Intronic
1059849185 9:118318140-118318162 AGGGAAGCCACAGTGGGGCTTGG - Intergenic
1060030693 9:120212501-120212523 AGGCAAGCAGCAAATGGCCAAGG + Intergenic
1061266415 9:129507868-129507890 TGGCCAGCAGCAGAGGGGCCAGG - Intergenic
1061328972 9:129880432-129880454 GGGCACTCAGCAGTGGGGCCGGG - Exonic
1061518016 9:131100775-131100797 AGAGAAGCAGGAGTGGGGCTGGG + Intronic
1062094572 9:134696140-134696162 ATGCAGGGGGCAGTGGGGCAGGG - Intronic
1062326930 9:136016973-136016995 CAGCAAGGGGCAGTGGGGCATGG + Intronic
1062448360 9:136605084-136605106 CAGCAAGCAGCGCTGGGGCAGGG + Intergenic
1062572071 9:137190370-137190392 GGGCAAGCAGCAGGCTGGCACGG - Exonic
1062674429 9:137732129-137732151 TGGCAAGCAGCAGTGGAGCCAGG - Intronic
1186422784 X:9439618-9439640 AAGCAAGCAGCCATGGGGCAAGG - Intergenic
1187558384 X:20374910-20374932 AGGGAAGCAACTCTGGGGCATGG - Intergenic
1187701510 X:21968168-21968190 TGGCCAGCAGCAGTGCTGCAGGG + Intronic
1188157329 X:26755991-26756013 CGGCAAACAGCAGTGGCGGATGG + Intergenic
1189000765 X:36942100-36942122 AGGTAAGAAGATGTGGGGCAGGG - Intergenic
1189135298 X:38543007-38543029 TTTCAAGCAACAGTGGGGCAAGG + Intronic
1189171840 X:38916734-38916756 TGGCAGGCAGCTGTGGGCCAGGG + Intergenic
1189312075 X:40026228-40026250 AGGCCAGAAGCAGGGGGGCGTGG + Intergenic
1189619136 X:42816792-42816814 GGGCAAGCCGCAGCAGGGCAGGG - Intergenic
1190708674 X:53050033-53050055 AGGAAAGAAGGAGTGGGGGATGG - Intronic
1191167488 X:57405562-57405584 CGGCAAACAGCAGTGGTGGATGG + Intronic
1191207907 X:57853667-57853689 GGGGAAGCAGCAGTGGGGTGAGG + Intergenic
1191866276 X:65706395-65706417 AGGCAAGTATAAGTGGGGCAGGG - Intronic
1191887263 X:65901464-65901486 AGGCAAGTAGCAGTGGTGATGGG + Intergenic
1192254874 X:69447982-69448004 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1192571972 X:72213538-72213560 TGGCAAACAGCAGTGGTGGACGG - Intronic
1192953634 X:76044477-76044499 TGGCAAGGAGCAGTGGGGATAGG + Intergenic
1193300354 X:79881600-79881622 AGGGAAGCAGCAGTGGGTAAAGG - Intergenic
1193306246 X:79956018-79956040 TGGCAAACAGCAGTGGTGGACGG - Intergenic
1193443972 X:81577346-81577368 TGGCAAGGAGCAGTGGGGGTAGG - Intergenic
1193492430 X:82165923-82165945 AGGGAAGCTGCAGTGAGGGAAGG - Intergenic
1195114778 X:101686248-101686270 AGGAAAGAAGGAGTGGTGCAGGG + Intergenic
1195259091 X:103115404-103115426 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1195441217 X:104900790-104900812 AAGCCAGCATCAGTGGAGCAAGG + Intronic
1196287281 X:113897473-113897495 CGGCAAACAGCAGTGGTGGATGG + Intergenic
1197777111 X:130125632-130125654 AGGGAAGGGGCAGTGGGGGAAGG + Intergenic
1197920626 X:131589981-131590003 AAGTAAGCAGCAGCTGGGCATGG + Intergenic
1197999720 X:132420349-132420371 CGGCAAACAGCAGTGGTGGATGG + Intronic
1200038652 X:153349916-153349938 CCGCCAGCAGCAGTGGGGCTTGG + Exonic
1201204597 Y:11571276-11571298 TGGAATGCAGCAGTGTGGCATGG + Intergenic
1201205249 Y:11576888-11576910 TGGAATGCAGCAGTGTGGCATGG + Intergenic
1201205898 Y:11582494-11582516 TGGAATGCAGCAGTGTGGCATGG + Intergenic
1201206546 Y:11588101-11588123 TGGAATGCAGCAGTGTGGCATGG + Intergenic