ID: 1051615145

View in Genome Browser
Species Human (GRCh38)
Location 9:18999636-18999658
Sequence CGGTGTGGCGGCCGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4094
Summary {0: 2, 1: 199, 2: 1206, 3: 1091, 4: 1596}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051615145_1051615152 -9 Left 1051615145 9:18999636-18999658 CCCTCTGCCCGGCCGCCACACCG 0: 2
1: 199
2: 1206
3: 1091
4: 1596
Right 1051615152 9:18999650-18999672 GCCACACCGTCTGGGAAGTGAGG 0: 14
1: 1976
2: 2715
3: 6377
4: 11822
1051615145_1051615157 22 Left 1051615145 9:18999636-18999658 CCCTCTGCCCGGCCGCCACACCG 0: 2
1: 199
2: 1206
3: 1091
4: 1596
Right 1051615157 9:18999681-18999703 TGCCCGGCCGCCACACCATCTGG No data
1051615145_1051615155 6 Left 1051615145 9:18999636-18999658 CCCTCTGCCCGGCCGCCACACCG 0: 2
1: 199
2: 1206
3: 1091
4: 1596
Right 1051615155 9:18999665-18999687 AAGTGAGGAGCGCCTCTGCCCGG 0: 600
1: 9309
2: 12337
3: 4383
4: 1109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051615145 Original CRISPR CGGTGTGGCGGCCGGGCAGA GGG (reversed) Intronic
Too many off-targets to display for this crispr