ID: 1051617095

View in Genome Browser
Species Human (GRCh38)
Location 9:19016671-19016693
Sequence TTTCTAATCTGTGGCACCAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 171}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051617095 Original CRISPR TTTCTAATCTGTGGCACCAA TGG (reversed) Intronic
904842522 1:33382328-33382350 TTTCTAATGTGGGTCACCAGAGG - Intronic
907301187 1:53487161-53487183 TTTCTAAGCTGCAGCATCAAAGG + Intergenic
908091219 1:60687210-60687232 TTTCTCATTTGTGGCAATAAGGG - Intergenic
911034041 1:93519955-93519977 TTTATAATCAGTGGCAACTATGG + Intronic
912193148 1:107364631-107364653 TTTCTTATGTGTGAAACCAAGGG - Intronic
912643026 1:111365214-111365236 ATTGGCATCTGTGGCACCAATGG + Intergenic
912755427 1:112321228-112321250 TCTCTAAACTGTGGAGCCAAGGG - Intergenic
916857491 1:168765597-168765619 TTTTTAATCTGAGGCCCCACAGG - Intergenic
918717583 1:187809506-187809528 TTTTTAACATCTGGCACCAAAGG + Intergenic
921296539 1:213709368-213709390 TTTGTATTCTGTGGGATCAATGG + Intergenic
923378488 1:233390893-233390915 CTTCTAAGGTGTGACACCAAAGG - Intergenic
923733663 1:236580355-236580377 TTTCTGAGCTGTAGCAGCAATGG - Intronic
924785002 1:247186734-247186756 TTTTTAATCTGTGGTTCAAATGG - Intergenic
1062969463 10:1635165-1635187 TTTTTAAACTGTGGCACCCATGG - Intronic
1063687118 10:8247423-8247445 TTGCTTATGTGTGGCACAAATGG - Intergenic
1065126696 10:22580733-22580755 TTCCTAAACAGTGGCCCCAAGGG - Intronic
1066793504 10:39092714-39092736 TTTCCAATCTGTTGAATCAAAGG - Intergenic
1066808820 10:39297058-39297080 TTTCCAATCTGTTCCATCAAAGG + Intergenic
1070747421 10:78942776-78942798 TTTCTCATCTGTACCATCAAGGG - Intergenic
1073349275 10:102808383-102808405 TTTTAAATGTGTGGCACAAAAGG - Intronic
1073637541 10:105215004-105215026 TTTCTAATCAGTGGGATTAAGGG - Intronic
1079166665 11:18050420-18050442 ATTTTAATCTGTGGAACCTATGG + Intergenic
1081262724 11:40981008-40981030 TTTCTCATCTGAGGAAGCAAAGG + Intronic
1082825724 11:57576768-57576790 TGTCTGATCTATGACACCAAGGG - Intergenic
1083262198 11:61529200-61529222 TTTCTTAACTGTGGTACCCAGGG - Intronic
1083852060 11:65373987-65374009 TTGCTAAACTGTTGCAACAAGGG + Intergenic
1085012008 11:73147872-73147894 TTTCTCATCTGTAACACCAGGGG + Intergenic
1087382684 11:97426936-97426958 TTTCTATTCTGTGGCAGGGATGG + Intergenic
1091497535 12:985470-985492 TTTCTTAGCTGTGAGACCAAAGG - Intronic
1093084317 12:14849842-14849864 TGTCTAATCTGTGGGACTAAAGG + Intronic
1093304964 12:17504945-17504967 TTTCGACTCTGTCCCACCAATGG - Intergenic
1093394024 12:18658138-18658160 TTCCTAATCTGAGGAACAAAAGG + Intergenic
1093595371 12:20952329-20952351 GTTCTAATCTGTGGCAAAGAAGG + Intergenic
1098036264 12:66305307-66305329 TTTCTCATCTGTAGCATGAAGGG + Intronic
1100145552 12:91673231-91673253 TCTTAAATCTGAGGCACCAAAGG + Intergenic
1100965548 12:100009520-100009542 CATCTGATCTGTGACACCAAGGG - Intergenic
1101790378 12:107921033-107921055 TTTGAAATCAGTGGCACCAGAGG - Intergenic
1102677394 12:114668033-114668055 TTTCTCATCTGAGGCACAAACGG + Intergenic
1104390571 12:128387975-128387997 TTTCTAAGCTCTGCCACCAGAGG - Intronic
1106311550 13:28558963-28558985 TTGCTGGTCTGTGACACCAAAGG - Intergenic
1107029482 13:35835937-35835959 TTTCCAGTCTGTGGCACATATGG - Intronic
1107555197 13:41511506-41511528 TTTCTTAGATGTGACACCAAAGG - Intergenic
1108261579 13:48662161-48662183 CTTGTCATCTGTGGCAACAAGGG - Intronic
1112169635 13:96957553-96957575 TTTCAAATCTGTGGGAAGAATGG - Intergenic
1115052672 14:29083400-29083422 TTTCTGATCTGTTGCCACAAAGG + Intergenic
1116463998 14:45211559-45211581 TTTATTATCTGTGCCAGCAAAGG - Intronic
1119776186 14:77250281-77250303 TTTCTAATCTGTGGCCTGCAGGG - Intronic
1121128760 14:91426889-91426911 TTTCTTTTCTGTGGCATCATCGG - Intergenic
1122447183 14:101778448-101778470 TTTCTTAGCTATGACACCAAGGG - Intronic
1123991664 15:25688070-25688092 TTTCAAATATGTGTCACTAATGG + Intronic
1125401133 15:39304389-39304411 TTTCTAATTTCTGCCATCAATGG + Intergenic
1126773614 15:52081003-52081025 ATTCTAGTCTGGGGCAGCAAAGG + Intergenic
1128608079 15:69052959-69052981 TTCCTAATCTGTGTAAACAAAGG + Intronic
1131836774 15:96398796-96398818 TTAATAAAGTGTGGCACCAAGGG - Intergenic
1134375474 16:13668540-13668562 TTTCTAAGGTTTGGCACCGAAGG + Intergenic
1135273173 16:21086318-21086340 TTTCTAATTTGTAGGCCCAAAGG + Intronic
1135501504 16:22999898-22999920 TTTCCAATAAATGGCACCAATGG - Intergenic
1136171510 16:28492609-28492631 TTTCTCATCTGTAACACCAGGGG - Intronic
1136564254 16:31060754-31060776 TTTCAAATCTGTGGATCCAGGGG + Intergenic
1136740226 16:32513788-32513810 TTTCTCATCTTTGGCCTCAATGG + Intergenic
1139008229 16:62599843-62599865 TTTAGAATCTGTGGCATCTATGG - Intergenic
1143473675 17:7191491-7191513 GTTCTCATCTGTGGCCCCAGAGG - Intronic
1144057084 17:11553016-11553038 TTTCTAATCAGTGTCATCATTGG - Intronic
1144997836 17:19282966-19282988 TTTCGAATCTGAGGCTCCAAAGG + Exonic
1147195598 17:38764558-38764580 ATTCTAAGCTCTGGCATCAATGG - Intergenic
1147939717 17:44037698-44037720 TTTCTAGCCAGTGGCACCCAAGG - Intronic
1149752218 17:59156597-59156619 TTTCAAAGCTGTAGCAGCAACGG - Intronic
1150446244 17:65228859-65228881 TTTCTCAACAGTGGCACCACTGG - Intergenic
1152398262 17:80048506-80048528 ATTCTATTCTGGGGCATCAATGG - Intronic
1155237676 18:23837393-23837415 TTTCTAAACTCTGGCAATAATGG - Intronic
1157738339 18:50070600-50070622 TTTCTCAACTGTGGCATTAATGG - Intronic
1159716606 18:71831671-71831693 TTAATAATCTGTGGCCCCAAAGG - Intergenic
1164332773 19:24276169-24276191 TTTCAAACCTGTGGAATCAAAGG + Intergenic
1165186095 19:34023113-34023135 TGTCTCATCTGTGGCATCAATGG - Intergenic
1167807459 19:51798394-51798416 TTTCTCAGCTTTGACACCAATGG - Intronic
925221682 2:2146916-2146938 TTTCTGCTCTGTGGAACAAATGG - Intronic
925917423 2:8616734-8616756 TTTCTCATCTGTGACTCCAAAGG - Intergenic
926543273 2:14207184-14207206 TTCCAAACCTGGGGCACCAATGG + Intergenic
927475554 2:23411814-23411836 TTTCTAATCTGAGTCACTTAGGG + Intronic
929090236 2:38209161-38209183 CTTCCAATCAGTGGCACCACTGG - Intergenic
930926776 2:56827767-56827789 TTTCTATCCTGTGGCACTAGTGG - Intergenic
935413294 2:102788304-102788326 GTTCTGATGTGTGGCAGCAATGG + Intronic
938976928 2:136487685-136487707 TTTCTCTACTGTGGCAGCAAGGG + Intergenic
941426437 2:165351255-165351277 TTTCAAAACTGTGTCACCACGGG + Intronic
942112840 2:172699924-172699946 TCTCTAATCTGAGGTACCCAGGG - Intergenic
942636958 2:178018014-178018036 AGTGTAATCTGTGGCACCCAAGG + Intronic
944663970 2:201943990-201944012 GTTCAAATCTGTGCCATCAAGGG + Intergenic
945462603 2:210127390-210127412 TTTCTTAGCTATGACACCAAAGG + Intronic
945729957 2:213521376-213521398 ATTCTAGTCTGTAGCACCCAAGG + Intronic
945846387 2:214949994-214950016 TTTCTAACCTTTGGATCCAAAGG + Intronic
945958769 2:216110198-216110220 TTACTGATCTGGGACACCAATGG - Intronic
946914601 2:224504787-224504809 TTTGGAATTTGTGACACCAAAGG - Intronic
948655752 2:239475846-239475868 CTTCTGCTCTGTGGCAGCAAGGG + Intergenic
1168925816 20:1578047-1578069 TCCCTCATCTGTGGAACCAAAGG + Intronic
1168929693 20:1611066-1611088 TCCCTCATCTGTGGAACCAAAGG + Intronic
1168934193 20:1648763-1648785 TTCCTCATTTGTGGAACCAAAGG + Intronic
1169320560 20:4629900-4629922 TGTCTGATCTGTGACACCAAGGG - Intergenic
1169589716 20:7126753-7126775 TTTCTAATCAGTGGCAAAAGGGG - Intergenic
1177638451 21:23815814-23815836 TTTCTGATATGTAGCACCAGGGG - Intergenic
1178971291 21:37179508-37179530 TTTCTTAGCTATGACACCAAAGG - Intronic
1179392464 21:41006461-41006483 TATGTAATATGTGGCCCCAAAGG - Intergenic
1184030459 22:41891376-41891398 TTTCTAATCACTGGGACCAGGGG - Intronic
949134115 3:541709-541731 TTTATTATCTGTGGTAGCAAGGG - Intergenic
952936477 3:38402212-38402234 TGTCTAAACTTTGCCACCAAAGG + Intronic
953881131 3:46692034-46692056 TTCCACATCTGTGGCCCCAAAGG + Intronic
958521455 3:95193238-95193260 ATTTTAATTTGGGGCACCAAAGG - Intergenic
959449397 3:106480744-106480766 TGTCTCAACTGTGGCACCAACGG + Intergenic
959655652 3:108801351-108801373 TTTCGATTCTGTGGGCCCAAGGG - Intergenic
959728511 3:109573470-109573492 TTGCTTTTCTGTGCCACCAATGG + Intergenic
963533830 3:146503370-146503392 TTTCTGATCTGTGACTCAAATGG - Intergenic
963534160 3:146507221-146507243 TTTCTAATCTGTGACTCCACTGG + Intergenic
964349654 3:155790377-155790399 TTTCTTAGATGTGACACCAAAGG + Intronic
969185953 4:5474374-5474396 CTTCTCATCTGTGCCATCAAGGG + Intronic
971850917 4:31985685-31985707 TCTCTAATGTGTTGTACCAATGG - Intergenic
974803754 4:66853805-66853827 TTTCTAACCTGTGGTACGTATGG + Intergenic
975894729 4:79075383-79075405 TTTCTTAGCTATGACACCAAAGG - Intergenic
976360120 4:84167934-84167956 TTTCTCAAATGTGGCACCACTGG + Intergenic
976479144 4:85519233-85519255 CTACTAATGTGTGGCACCAAAGG - Intronic
981480489 4:145233762-145233784 TTTCTAAACTGTGGTGCAAAGGG + Intergenic
981724547 4:147833876-147833898 TTTCGAAGCTGTGGCAGCCATGG + Intronic
983089285 4:163485270-163485292 TATCTAATCTATGGGACCTATGG + Intergenic
983331563 4:166335244-166335266 TTTCTAATCTGTGAAGGCAACGG + Intergenic
986763371 5:10900151-10900173 TTTATAATCTGTGGAATGAATGG + Intergenic
988641935 5:33049854-33049876 TGCCTCAGCTGTGGCACCAAGGG - Intergenic
989281728 5:39652066-39652088 TTTCTCATCTGTGAAACCAAAGG - Intergenic
989432448 5:41371654-41371676 TTTATTATCTGTTGCAGCAAGGG - Intronic
992892149 5:81213397-81213419 CTTCTATTCTCTGGCACCAATGG - Intronic
994406976 5:99357500-99357522 TTTCTAATCTGTGACATAAAAGG - Intergenic
995049012 5:107681261-107681283 TTTCTAATGTGTGCCATCTAGGG + Intergenic
995234459 5:109811114-109811136 TATATAATCTGTGGTACAAAAGG - Intronic
995572074 5:113491089-113491111 TTACTAATCTCTGGAACAAAAGG - Intergenic
997239568 5:132296520-132296542 TGTCGAATCTGTGGCACCTGTGG + Intronic
998214998 5:140231287-140231309 TTTCTAATGTGTGATCCCAATGG - Intronic
1000034937 5:157439013-157439035 TTTCTTGGATGTGGCACCAAAGG + Intronic
1003050242 6:2774048-2774070 TTTCTATTCAATGGCACAAAAGG - Intronic
1003339936 6:5210331-5210353 TTTCTCATCTGTAAAACCAAAGG - Intronic
1003720467 6:8696292-8696314 TTTCTAATCTATGACACGGAAGG + Intergenic
1004197873 6:13521558-13521580 TGTCTGATCTATGACACCAAGGG + Intergenic
1004465592 6:15882101-15882123 TTTCTAATTTTTGGCAGAAATGG + Intergenic
1005325883 6:24700222-24700244 TTACTCATCTGTAGCACAAAGGG + Intronic
1005661798 6:28005616-28005638 TTTATTATCTGTGCCAGCAAGGG - Intergenic
1007847490 6:44771952-44771974 ATTCTTCTTTGTGGCACCAAAGG + Intergenic
1009611891 6:65955394-65955416 TTACTAATCTCTTGCACAAAAGG - Intergenic
1011091290 6:83603660-83603682 TTTCTAATCTGTCTCACTACAGG - Intronic
1012148195 6:95712592-95712614 TTTCTAAAATATGACACCAAAGG + Intergenic
1012554651 6:100496916-100496938 TTTCTTGTCTATGACACCAAAGG - Intergenic
1013150452 6:107440858-107440880 TATCTAAGCTGGGCCACCAATGG + Intronic
1014877830 6:126683325-126683347 TGTCTGATCTATGACACCAAGGG + Intergenic
1014964211 6:127726399-127726421 TTTCTAATCAGTTACAGCAAGGG - Intronic
1015483673 6:133744088-133744110 TTTTTCATATGTGGCACTAAAGG + Intergenic
1017889073 6:158624634-158624656 TTTCTTATCTGTGACACGAGGGG - Intronic
1020753722 7:12174175-12174197 TTTCTTATATGTGGCAGCAAAGG + Intergenic
1022251863 7:28616211-28616233 TTTCTATTAGGAGGCACCAATGG + Intronic
1022403763 7:30066811-30066833 TTTCTATTCTGTGCCAGAAAAGG - Intronic
1023893863 7:44415852-44415874 TTTTTTGTCTGTGGCACCTATGG - Intronic
1024376550 7:48645350-48645372 TTTCTAATAAGTGAGACCAAAGG + Intronic
1026244811 7:68610566-68610588 CTTCTAATCCGTGGTACCCAAGG - Intergenic
1028528428 7:91811256-91811278 TTTCTCATTTGTGCCACCCACGG + Intronic
1034046572 7:147935037-147935059 TTTCTAAACTGTATGACCAAAGG - Intronic
1035003564 7:155637397-155637419 TCTCTACTCTGCAGCACCAAGGG + Intronic
1035120961 7:156566575-156566597 ATTCTAATCTCTGCCTCCAAGGG - Intergenic
1035757518 8:2045193-2045215 TTTCTAATTTGTGGCTTTAAGGG + Intronic
1037036363 8:14173031-14173053 GTTCTAAACTGTGGCACTCAGGG - Intronic
1037122607 8:15307035-15307057 TGTCTCAACTATGGCACCAAGGG + Intergenic
1037462543 8:19127209-19127231 TTACTATTCTGTGGGACAAAGGG - Intergenic
1038551327 8:28471891-28471913 TTTCTCATCTGTGCCTCAAAAGG - Intronic
1039778894 8:40764223-40764245 ATTTTACTCTGTGGCCCCAAGGG + Intronic
1040118359 8:43651296-43651318 TTTCCAAACTGTGGAATCAAAGG - Intergenic
1042161575 8:65902043-65902065 TTTCTCATCTGTGGAACTCAGGG + Intergenic
1042865728 8:73355471-73355493 TTTCTAAACTGTGGCTCCCCTGG + Intergenic
1043187198 8:77168470-77168492 TCTCTACTCTATGGTACCAATGG + Intergenic
1047787683 8:128169495-128169517 TTTCTAGGCTCTGGCCCCAAAGG - Intergenic
1048327239 8:133449250-133449272 TTTCTTAGCTGTGTGACCAATGG - Intergenic
1050531116 9:6590111-6590133 TTTCTTAAATGTGACACCAAAGG + Intronic
1051617095 9:19016671-19016693 TTTCTAATCTGTGGCACCAATGG - Intronic
1054839694 9:69723318-69723340 TTTCTTACCTATGACACCAAAGG + Exonic
1056133140 9:83604968-83604990 TTTCTAATCTGTTAGATCAAGGG - Intergenic
1056371884 9:85964006-85964028 TTTCTAATCTTTGCCAACAATGG - Intronic
1056640736 9:88368408-88368430 TTTCTTATCTGTGCAGCCAAGGG - Intergenic
1057940438 9:99277754-99277776 TTTTTAAAATGTTGCACCAATGG + Intergenic
1059137298 9:111819478-111819500 TCTCAAATCTGTGGCAATAATGG + Intergenic
1059770219 9:117416823-117416845 TTACTAATCTGTGAACCCAAAGG + Intergenic
1186605077 X:11080946-11080968 TTTCTAAACTCTGGCCCCAGGGG - Intergenic
1188021640 X:25165091-25165113 TTTTTAGGCTGTGGGACCAAGGG + Intergenic
1198851120 X:140966345-140966367 TTTATTATCTGTGCCAGCAAGGG - Intergenic
1198993014 X:142537918-142537940 TTTATAAACTGTGAGACCAAAGG - Intergenic
1199891715 X:152089888-152089910 TTGCTAATCTGTACCTCCAAGGG + Intergenic
1201179222 Y:11330489-11330511 TTTCTACTCTGTGGCTACAGAGG - Intergenic