ID: 1051621890

View in Genome Browser
Species Human (GRCh38)
Location 9:19058869-19058891
Sequence TCTCTTTGATTGTGCAACAC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 2, 1: 0, 2: 2, 3: 8, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051621888_1051621890 25 Left 1051621888 9:19058821-19058843 CCAAAATCTGATACAGTGGTTTC 0: 2
1: 1
2: 2
3: 16
4: 130
Right 1051621890 9:19058869-19058891 TCTCTTTGATTGTGCAACACAGG 0: 2
1: 0
2: 2
3: 8
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051621890 Original CRISPR TCTCTTTGATTGTGCAACAC AGG Exonic