ID: 1051627862

View in Genome Browser
Species Human (GRCh38)
Location 9:19115196-19115218
Sequence AAATTTTACTAGGTGACAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051627862 Original CRISPR AAATTTTACTAGGTGACAGT TGG (reversed) Intronic
907785688 1:57610451-57610473 AAACTTTGCCAGGTGACATTGGG - Intronic
909058111 1:70846253-70846275 AAATTTTACTAAGTGCTAGAAGG + Intergenic
911705017 1:101000957-101000979 ACAATTGACTAGGTGACATTGGG + Intronic
916329371 1:163596853-163596875 AAAATTTTCTAGTTGACAATTGG + Intergenic
917407032 1:174718220-174718242 AAATTTTCCCAGGTGAAATTAGG - Intronic
917960945 1:180144082-180144104 AAATTTTTCTAGCTGACATTAGG - Intergenic
918584267 1:186167759-186167781 AAATGTTACTAAGTGAAAGAAGG - Intronic
921384639 1:214556331-214556353 AAAGTTTACCAGGGGACAGCTGG + Intergenic
922396294 1:225204700-225204722 ACACTTTACTATGTGCCAGTGGG + Intronic
924826738 1:247547574-247547596 AAATTTTAGTAGGGAACAGGAGG + Intronic
1065043809 10:21726387-21726409 AAATTAAAGTAGGTGAGAGTAGG - Intronic
1066162093 10:32744895-32744917 AAAGATTCCTAGGTGACATTGGG - Intronic
1066271793 10:33831200-33831222 AAATTCTAATAGGTAACATTTGG + Intergenic
1067266027 10:44745959-44745981 AAAATTTTCTGGTTGACAGTTGG + Intergenic
1070904834 10:80062891-80062913 AAATTTTCCTGGTTGACAATTGG + Intergenic
1071119659 10:82262703-82262725 ATATTTTAATAAGTGACACTAGG + Intronic
1071377340 10:85022045-85022067 AAAATTAAATAGGTGACAGGTGG + Intergenic
1072056113 10:91757799-91757821 GAATTTTACTAGGTGTCTCTGGG + Intergenic
1072334178 10:94382730-94382752 AAATTTTGCTAGCTGAAAATAGG - Intergenic
1073527447 10:104197892-104197914 ATATTTTACTGTGTCACAGTAGG - Intronic
1073741601 10:106414295-106414317 AAATTTCACAAGGTTACAGAGGG + Intergenic
1075110985 10:119584279-119584301 GAATTTTAATATCTGACAGTTGG - Intronic
1075704754 10:124493897-124493919 AAATGTTTCCAGGTAACAGTTGG + Intronic
1084217934 11:67661133-67661155 AAATTTTCCTGGTTGACAATTGG - Intergenic
1086223230 11:84475510-84475532 AAATTTTACTCTTTGCCAGTGGG + Intronic
1086814567 11:91352984-91353006 AAATTGTACCAAGTAACAGTAGG - Intergenic
1087279242 11:96191810-96191832 AAATTCTACTATGTGAAAGGAGG + Intronic
1088087138 11:105994884-105994906 AAAATTTTCTGGGTGACAATTGG + Intergenic
1088129312 11:106467871-106467893 CAATTTTTCTAGTTGACAATTGG - Intergenic
1089377616 11:118005713-118005735 GAATTTGACCAGATGACAGTGGG - Intergenic
1092405602 12:8220010-8220032 GAATTTTACTAGGTGTGTGTTGG + Intergenic
1092653626 12:10661541-10661563 AAACTGTACTAGGTAATAGTGGG - Intronic
1093339368 12:17952298-17952320 AAATTGTAATATGAGACAGTGGG + Intergenic
1093682543 12:22019091-22019113 TAATTTTACTACCAGACAGTAGG - Intergenic
1094182878 12:27610916-27610938 AAATTTTACTAGGGGTGAGGTGG + Intronic
1095399643 12:41799875-41799897 AGATTTCACTAGGTGAGAGGAGG - Intergenic
1096257356 12:50071615-50071637 AAATTTTGCCAGGAGGCAGTGGG + Intronic
1096353915 12:50924090-50924112 AAATTTTTCTGGTTGACAATTGG + Intronic
1098080930 12:66785072-66785094 ATATTTTACTAGGTCACCATAGG + Intronic
1099824369 12:87756119-87756141 AAATTTTACTAAATAGCAGTTGG + Intergenic
1100945551 12:99778921-99778943 AGGTTTTATTAGGTGTCAGTTGG - Intronic
1101325757 12:103714389-103714411 AAATGTTAATAGGTGAATGTGGG - Intronic
1101731430 12:107429597-107429619 AAAGTCTACTAGCTGCCAGTGGG + Intronic
1101831247 12:108258518-108258540 AAGTTTGAATAGGTGAAAGTGGG - Intergenic
1101843676 12:108345174-108345196 AATATTTACTACATGACAGTTGG - Intergenic
1104512575 12:129393950-129393972 AAATATTTCTACTTGACAGTGGG - Intronic
1105613853 13:21994585-21994607 AAATTTTACAGGCTCACAGTTGG + Intergenic
1110589158 13:77234401-77234423 AAATTTTATTAGAGGGCAGTAGG - Intronic
1111530465 13:89530068-89530090 GAATTTTACTGAGTGACAGAAGG - Intergenic
1111941228 13:94609956-94609978 AAATTTTCCTAGTGGAAAGTTGG - Intronic
1112909374 13:104462836-104462858 AAATTTTACAGGCTGACAGGTGG - Intergenic
1114243850 14:20894185-20894207 AAATTTTGCTAAGTGTCAGGAGG + Intergenic
1114246918 14:20922761-20922783 AAATTTTGCTAAGTGTCAGGAGG + Intergenic
1114393302 14:22333289-22333311 ACATTTTAGTAGGTGACAATAGG - Intergenic
1115509163 14:34123093-34123115 AAATTCTACAAGGTAACAATTGG + Intronic
1117049932 14:51849721-51849743 GAAGTTTACTAGGTGCCAGAAGG - Intronic
1120318950 14:82934377-82934399 ACATTTTACTAGGTTAGTGTAGG - Intergenic
1120413970 14:84195327-84195349 AAATTTGACAAGATGAGAGTTGG + Intergenic
1121763439 14:96465007-96465029 AAATATTTCTAGGGTACAGTTGG - Intronic
1122217869 14:100215689-100215711 ACATTTTATCAGGGGACAGTGGG + Intergenic
1124664220 15:31578466-31578488 AAATTTTTCTAATTGGCAGTTGG - Intronic
1125134807 15:36328967-36328989 GAATTTTACTGAGTGACAGAAGG + Intergenic
1128184578 15:65633813-65633835 GACTCTTACTGGGTGACAGTGGG + Intronic
1130412324 15:83657232-83657254 AAATTTTATAAGGTGAAAGAAGG - Intronic
1131808702 15:96150119-96150141 AAATATCACTAGATGACAGCTGG - Intergenic
1133596035 16:7293736-7293758 AAAACTTACAAGGTGACACTGGG - Intronic
1135204741 16:20473976-20473998 AAATTTTTCTGGTTGACAATTGG - Intronic
1137490035 16:48924708-48924730 AACAATTACCAGGTGACAGTGGG + Intergenic
1138666557 16:58574119-58574141 AAATTTAACCAGCTGAGAGTGGG + Intronic
1139415594 16:66806199-66806221 AATTTTTACTAGGTTTTAGTTGG - Intronic
1143383535 17:6510948-6510970 CCATTTGACTAGGAGACAGTGGG + Intronic
1145875238 17:28314402-28314424 AAATTTGGCTAGGTGACATTTGG + Intergenic
1149559012 17:57594781-57594803 AGCTTTTACTGGGTGACACTGGG + Intronic
1151078275 17:71299378-71299400 AATTTTGTCTGGGTGACAGTGGG - Intergenic
1153015169 18:576726-576748 GAATTTTAATAGGTGAAAGAAGG - Intergenic
1154468890 18:14678708-14678730 AAAATTTGCTGGGTGACAGCAGG + Intergenic
1156017841 18:32566369-32566391 AATCTTTACTAGGTGAGAATAGG - Intergenic
1156897911 18:42267589-42267611 GAATTTTACCAGGTGATGGTTGG - Intergenic
1158006292 18:52675382-52675404 AAAATTTTCTAGTTGACAATTGG - Intronic
1158758270 18:60352259-60352281 AAATTTTACAAAGTGAATGTTGG - Intergenic
1165183802 19:33998782-33998804 GACTTTTACTAGATGACAGAGGG - Intergenic
1167359998 19:49024903-49024925 AAATCTTACTTGGTGAGAGCAGG - Intronic
1167361086 19:49030868-49030890 AAATCTTACTTGGTGAGAGTGGG + Intronic
1167362566 19:49037929-49037951 AAATCTTACTTGGTGAGAGCAGG - Intergenic
1167363565 19:49043255-49043277 AAATCTTACTTGGTGAGAGTGGG + Intergenic
1167364931 19:49049671-49049693 AAATCTTACTTGGTGAGAGCAGG - Intergenic
926811242 2:16757036-16757058 AAACTTCACGAGGTGACGGTGGG + Intergenic
927163905 2:20297807-20297829 AATTTTTACTAAGTGACCTTGGG + Intronic
928671602 2:33608870-33608892 AAATTTTTCTGGTTGACAATTGG - Intergenic
930680453 2:54252330-54252352 GAATTTTAATAGCTGACACTGGG - Intronic
930807185 2:55502851-55502873 AAATTTGACTAGAAGCCAGTCGG - Intergenic
932679194 2:73808692-73808714 AGATTCTACCAGGTGGCAGTTGG - Intronic
935519791 2:104090653-104090675 AAATTATACTATGTCACATTTGG + Intergenic
936966367 2:118131221-118131243 AGGTTTTCCTAGGTGACAGATGG + Intergenic
937264898 2:120609209-120609231 ACATTTTCCTTGGTGACATTGGG - Intergenic
940209908 2:151245657-151245679 AACATTTTCTAGTTGACAGTTGG + Intergenic
941413723 2:165192705-165192727 GGATTTTAAGAGGTGACAGTTGG - Intronic
942566892 2:177274513-177274535 AAATGATACCAGGTGACTGTTGG - Intronic
943162015 2:184266686-184266708 ACATTTTGCTAGGTGAATGTAGG + Intergenic
946345265 2:219104595-219104617 AACTTTTACTACATGACAGAAGG + Intronic
947124017 2:226848427-226848449 ATATCTTACTAGTAGACAGTTGG + Intronic
947165825 2:227260940-227260962 ATATTTGTCTAGGTGAGAGTAGG + Intronic
947674961 2:231970192-231970214 ACACTTTAAGAGGTGACAGTGGG - Intronic
1168926183 20:1581401-1581423 CAATGTCACTAGGTCACAGTAGG - Intronic
1168942471 20:1725134-1725156 GAATATCACTAGGTTACAGTAGG - Intergenic
1170713747 20:18814724-18814746 AAACTTTACTATGAGACTGTGGG + Intronic
1170768506 20:19312131-19312153 ACATTTTTCTAAGTGGCAGTGGG + Intronic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1171743721 20:28938027-28938049 AAATTCTACAAGGGGACATTTGG + Intergenic
1176805629 21:13478953-13478975 AAAATTTGCTGGGTGACAGCAGG - Intergenic
1177437988 21:21081347-21081369 AAATAATACTTGGTGACAGCCGG - Intronic
1183122522 22:35741135-35741157 AAATTGAACTAGGTGACATGAGG + Intronic
949239690 3:1855654-1855676 GAATTTTAACAGATGACAGTTGG + Intergenic
950121941 3:10487848-10487870 AAATTTTACTCAGAGGCAGTGGG - Intronic
950582757 3:13873317-13873339 AAATGTCACCAGGTGACATTTGG - Intronic
950941861 3:16901058-16901080 TAATTTTTCTAAGTAACAGTGGG - Intronic
952096222 3:29957752-29957774 TACTTTTACAAGGTGACACTGGG - Intronic
957121402 3:76099009-76099031 CAATATAGCTAGGTGACAGTGGG + Intronic
957472975 3:80683403-80683425 AAATGTGACTATGTGACAGATGG - Intergenic
957672156 3:83319285-83319307 AAAATTTTCTAGTTGACAATGGG - Intergenic
958998916 3:100939162-100939184 GAGTTTTACTAGGTCCCAGTAGG + Intronic
962669160 3:137687344-137687366 CAATTCTTCTAGGAGACAGTAGG - Intergenic
967205601 3:187117918-187117940 AGATTTCATTAGGTGACAGATGG + Intergenic
967548438 3:190760537-190760559 AAATTTTGTTAACTGACAGTGGG - Intergenic
967928384 3:194671548-194671570 ATATTTTACTAGGTTATAGAAGG - Intronic
967932189 3:194698235-194698257 AAATTTGCCTAGGTTACAGGGGG - Intergenic
968924536 4:3540101-3540123 AAAATTTTCTGGGTGACAATTGG - Intergenic
969760509 4:9177961-9177983 GAATTTTACTAGGTGTGTGTTGG - Intergenic
970935733 4:21567866-21567888 ACATTTTTCTAGGTACCAGTGGG + Intronic
971125173 4:23746082-23746104 AAATTTTAATTGGTGTGAGTAGG - Intergenic
971747077 4:30596239-30596261 ACATTTTACTGGGGAACAGTGGG - Intergenic
972777505 4:42256572-42256594 AAATATTATTTTGTGACAGTTGG + Intergenic
973177974 4:47231527-47231549 AAAATTTACTGGATCACAGTAGG + Intronic
974828973 4:67166918-67166940 AAATTTTATTTGGTGAAATTAGG + Intergenic
976403374 4:84634330-84634352 ATGTTTTTCTAGGTGAAAGTTGG + Intronic
977070076 4:92374341-92374363 AATTTTTTCTGGTTGACAGTTGG - Intronic
978594213 4:110359255-110359277 AACTATTACTAAGTGACAGCTGG - Intergenic
979532305 4:121781640-121781662 TTATTTGACTATGTGACAGTGGG - Intergenic
979949086 4:126869168-126869190 AAATTGTACTAGTTGGCATTTGG - Intergenic
980776223 4:137439431-137439453 AAATCTTTCTAGCTGAAAGTAGG + Intergenic
981213053 4:142131377-142131399 CATTTTTACTAGGTGAATGTAGG + Intronic
983797948 4:171889098-171889120 AAATTTTAATAGATGTCAGTAGG + Intronic
989639890 5:43573752-43573774 AAATTTTACTCTTTGACAGAGGG + Intergenic
991082939 5:62620606-62620628 AAATTTTTCTGGTTGACAGTTGG + Intronic
993073841 5:83201382-83201404 GCATTTTACTAGGGGCCAGTGGG - Intronic
994735959 5:103556504-103556526 AAATATTACTAGGAAACTGTAGG + Intronic
995493800 5:112720893-112720915 AGATTTTACCAGGTAACAGAGGG + Intronic
998261843 5:140637801-140637823 AAATTTTTCTGGTTGACAATTGG - Intergenic
1000429112 5:161129835-161129857 AAATGATACTTGGTGACTGTGGG + Intergenic
1000838576 5:166187483-166187505 AAATTTTACTAGGCAACAGTTGG + Intergenic
1002677866 5:180934088-180934110 AAATCATACTTGGTCACAGTGGG - Intronic
1003353322 6:5341294-5341316 AACTTTTCCTGGGAGACAGTGGG + Intronic
1004137811 6:12985077-12985099 AAATTTTAGTTGGTTTCAGTTGG - Intronic
1004737775 6:18425164-18425186 CCACTTTACTAGGTGACAATGGG - Intronic
1005164329 6:22902200-22902222 TTAATTTACTAGGTGACATTGGG - Intergenic
1006788428 6:36683281-36683303 AGGTTTTACTAGGTGACCCTGGG - Intronic
1007136437 6:39526180-39526202 AAATTGTCCAAGGTGACAGCTGG - Intronic
1007583115 6:42971251-42971273 AATTATAAATAGGTGACAGTGGG + Intronic
1007755729 6:44098033-44098055 AGCTCTTAGTAGGTGACAGTTGG - Intergenic
1008826966 6:55707534-55707556 AAATTATATTAGAAGACAGTAGG + Intergenic
1012175526 6:96077529-96077551 AGATTTTACAAGGTGAGAGGAGG - Intronic
1014965391 6:127741816-127741838 AAAATCCATTAGGTGACAGTTGG + Intronic
1015720953 6:136241429-136241451 AAATTCTAGTAAGTAACAGTAGG - Exonic
1015824453 6:137296760-137296782 AAATTTTTCTGGTTGACAATTGG - Intergenic
1016117151 6:140301547-140301569 AAATTTTTCTGGTTGACAATTGG - Intergenic
1016712847 6:147193137-147193159 AAACTTGACTAGGTGAAAGGGGG + Intergenic
1018561334 6:165103460-165103482 AAATTTTTCTGGTTGACAATTGG + Intergenic
1019151492 6:170009080-170009102 AAATTTTTCTGGTTGACAATTGG + Intergenic
1020670931 7:11110876-11110898 AAATTCTACTAGGCTACACTAGG - Intronic
1021532738 7:21667047-21667069 AAATTTTGCTGGGTGAAAATTGG - Intronic
1021978316 7:26030447-26030469 AAATTTTCCTGGTTGACAATTGG + Intergenic
1022595454 7:31709424-31709446 AAATTATCCTATGTTACAGTTGG - Intergenic
1022799172 7:33759366-33759388 AAATATTATTAGGTGACTGTTGG - Intergenic
1023629722 7:42152184-42152206 TAATTTTGTTAGGTGACAGGAGG - Intronic
1025767285 7:64467361-64467383 AAATTTTATGAGGTGAAACTTGG + Intergenic
1025788892 7:64669320-64669342 AAATTTTATGAGATGAAAGTTGG + Intronic
1026434468 7:70383369-70383391 AAATTTTACTATGGGACTTTAGG - Intronic
1028005993 7:85568129-85568151 TAAATTTACTATGTGACATTAGG + Intergenic
1028293227 7:89093994-89094016 ACATTTAACTAGCTAACAGTAGG - Intronic
1028529604 7:91824474-91824496 AAACTTTTCCAGGTGACACTAGG - Intronic
1029049509 7:97670003-97670025 AAATGTTCCCAGGTGAGAGTGGG + Intergenic
1031022283 7:116641157-116641179 TGATTTTACTAGGTAGCAGTTGG - Intergenic
1032918912 7:136524082-136524104 AAATTTAACTTGGTGACTGAAGG + Intergenic
1033523369 7:142184906-142184928 AAATTACATTAGGTGAAAGTAGG - Intronic
1033549885 7:142437636-142437658 AAATTTTTCTGGTTGACAATTGG + Intergenic
1034674722 7:152884171-152884193 AAATTTTACGAGGTATCAATTGG - Intergenic
1036264154 8:7261707-7261729 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036265449 8:7269329-7269351 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036268057 8:7284573-7284595 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036269361 8:7292195-7292217 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036270628 8:7299815-7299837 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036297231 8:7547229-7547251 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036298533 8:7554884-7554906 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036299838 8:7562534-7562556 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036301145 8:7570180-7570202 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036302447 8:7577829-7577851 GAATTTTACTAGGTGTGTGTTGG + Intergenic
1036303739 8:7585474-7585496 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036317506 8:7727894-7727916 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036318814 8:7735542-7735564 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036320121 8:7743189-7743211 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036321430 8:7750837-7750859 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036322739 8:7758485-7758507 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036324040 8:7766134-7766156 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036325340 8:7773790-7773812 GAATTTTACTAGGTGCGTGTTGG - Intergenic
1036350721 8:8010529-8010551 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036352001 8:8018173-8018195 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036353301 8:8025819-8025841 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036354593 8:8033466-8033488 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036845999 8:12170957-12170979 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1036867364 8:12413276-12413298 GAATTTTACTAGGTGCGTGTTGG + Intergenic
1037548728 8:19949455-19949477 ATATTTTAATAGGTGTAAGTAGG + Intronic
1039127922 8:34224923-34224945 AAATTTTACTTTGTGTCAATGGG + Intergenic
1039266604 8:35831302-35831324 AGTTTTTACTATGTGACAGCTGG - Intergenic
1040997914 8:53420381-53420403 AAATTTTTCTGGTTGACAATTGG - Intergenic
1041091270 8:54303200-54303222 CAACTTTTGTAGGTGACAGTGGG + Intergenic
1042477557 8:69266261-69266283 AATTTTTAGTAGGTGAGAGAAGG + Intergenic
1044575420 8:93763594-93763616 ATATTTTACTATGTGAGAATAGG + Intronic
1044744153 8:95355973-95355995 AAATTTTACTAGGTGTTATGTGG + Intergenic
1046445079 8:114308032-114308054 AAATTTTACTGCCCGACAGTTGG + Intergenic
1046497042 8:115027381-115027403 AAATTTTCCTAAGTGTCATTAGG + Intergenic
1047823252 8:128544822-128544844 AAATTTAAATTGGTCACAGTAGG + Intergenic
1047992567 8:130301382-130301404 AAATGCTACTAGGTAACAGAAGG - Intronic
1051271183 9:15356372-15356394 AAATTTTTCTGGCTGACAATTGG - Intergenic
1051627862 9:19115196-19115218 AAATTTTACTAGGTGACAGTTGG - Intronic
1052130181 9:24835081-24835103 AAATTTTATTTGTTGACAATGGG - Intergenic
1052641397 9:31170130-31170152 AAATTCTACTTGGTTATAGTAGG + Intergenic
1053087062 9:35234290-35234312 AAATTTTTCTGGGAGACACTAGG + Intronic
1054145597 9:61558869-61558891 AAAATTTTCTGGGTGACAATTGG + Intergenic
1054465337 9:65489977-65489999 AAAATTTTCTGGGTGACAATTGG + Intergenic
1056721732 9:89077924-89077946 CAATTTTATTACGTGTCAGTCGG + Intronic
1057249764 9:93491285-93491307 AAATTGTAATGGGTGACAATGGG + Intronic
1057956893 9:99417118-99417140 TAATTTTCCCAGGGGACAGTAGG + Intergenic
1058155237 9:101507377-101507399 TAACTTTATTAGGAGACAGTTGG - Intronic
1058432896 9:104934648-104934670 AAATTTTTCTGGTTGACAATTGG + Intergenic
1059837601 9:118173494-118173516 AAATTTTTCCAGGTGACTTTGGG + Intergenic
1059883435 9:118717845-118717867 GAATTTTACTAACTGACAGGAGG - Intergenic
1186305647 X:8254336-8254358 AAATTTAAAAAGTTGACAGTGGG + Intergenic
1186473509 X:9839086-9839108 AAATTTCACCAGGTGGCACTGGG + Intronic
1186559794 X:10599153-10599175 AAATCTTCCTAAGGGACAGTTGG - Intronic
1186942973 X:14531715-14531737 AAATATTAATAGTTGATAGTTGG + Intronic
1187369022 X:18688865-18688887 AAAATGTTCTAGTTGACAGTTGG + Intronic
1190197868 X:48335103-48335125 AAAATTTTCTAGTTGACAATTGG - Intergenic
1190664613 X:52685537-52685559 AAAATTTTCTAGTTGACAATTGG - Intronic
1190674809 X:52772881-52772903 AAAATTTTCTAGTTGACAATTGG + Intronic
1190691714 X:52918186-52918208 AAATTGTCCTGGGTTACAGTAGG + Intergenic
1190694269 X:52937606-52937628 AAATTGTCCTGGGTTACAGTAGG - Intronic
1190933768 X:54974495-54974517 AAATTTTACAAGATAACATTGGG + Intronic
1192562479 X:72136533-72136555 AAATGTGACCAGGTGACTGTAGG + Intronic
1193869437 X:86778949-86778971 ACATTTTACTATGTGCCAGGGGG + Intronic
1193974730 X:88103143-88103165 AAATTTTTCTAATTGGCAGTTGG - Intergenic
1194901596 X:99519126-99519148 AAATTTTAATAATTGACAATTGG - Intergenic
1195974959 X:110516716-110516738 ACATTAGACTAGGTGACTGTTGG - Intergenic
1198857724 X:141035539-141035561 AAATTTTACTATGATACATTTGG + Intergenic
1198904974 X:141551832-141551854 AAATTTTACTATGATACATTTGG - Intergenic
1199891002 X:152081846-152081868 AAATCTTTCTAGGTAACAATAGG + Intergenic
1202059463 Y:20871221-20871243 AACTTTTACAAGGTGAATGTTGG + Intergenic