ID: 1051629256

View in Genome Browser
Species Human (GRCh38)
Location 9:19127364-19127386
Sequence CGCCGCTGGGGGCCCGGGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 304
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 279}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051629242_1051629256 -5 Left 1051629242 9:19127346-19127368 CCCCCCACCCCAACTGGGCGCCG 0: 1
1: 0
2: 0
3: 16
4: 208
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629238_1051629256 4 Left 1051629238 9:19127337-19127359 CCCGGGGAGCCCCCCACCCCAAC 0: 2
1: 1
2: 5
3: 81
4: 526
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629246_1051629256 -9 Left 1051629246 9:19127350-19127372 CCACCCCAACTGGGCGCCGCTGG 0: 1
1: 0
2: 1
3: 12
4: 111
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629244_1051629256 -7 Left 1051629244 9:19127348-19127370 CCCCACCCCAACTGGGCGCCGCT 0: 1
1: 0
2: 0
3: 10
4: 129
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629235_1051629256 12 Left 1051629235 9:19127329-19127351 CCCAAGGCCCCGGGGAGCCCCCC 0: 1
1: 0
2: 5
3: 24
4: 312
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629236_1051629256 11 Left 1051629236 9:19127330-19127352 CCAAGGCCCCGGGGAGCCCCCCA 0: 1
1: 0
2: 4
3: 35
4: 564
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629237_1051629256 5 Left 1051629237 9:19127336-19127358 CCCCGGGGAGCCCCCCACCCCAA 0: 1
1: 1
2: 5
3: 29
4: 347
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629239_1051629256 3 Left 1051629239 9:19127338-19127360 CCGGGGAGCCCCCCACCCCAACT 0: 2
1: 0
2: 6
3: 60
4: 469
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629245_1051629256 -8 Left 1051629245 9:19127349-19127371 CCCACCCCAACTGGGCGCCGCTG 0: 1
1: 0
2: 0
3: 13
4: 121
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279
1051629243_1051629256 -6 Left 1051629243 9:19127347-19127369 CCCCCACCCCAACTGGGCGCCGC 0: 1
1: 0
2: 0
3: 13
4: 171
Right 1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG 0: 1
1: 0
2: 1
3: 23
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051629256 Original CRISPR CGCCGCTGGGGGCCCGGGAC CGG Intronic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900307755 1:2019401-2019423 GGCCGCGGCGGGCTCGGGACGGG - Exonic
900647851 1:3717171-3717193 GGCAGCTGGGTGCCCGGCACGGG - Intronic
900746826 1:4366302-4366324 CGCTGCAGAGGGCCCGGGGCAGG + Intergenic
901016703 1:6235991-6236013 CGCCGATGCCGGCCCGGGAAGGG + Intergenic
901496778 1:9626985-9627007 CGCTGCTGGGGTCCTGGGGCAGG - Intergenic
901500989 1:9652447-9652469 CAACGCGGGAGGCCCGGGACTGG - Intronic
901829098 1:11881303-11881325 TTCCGCTGTGGGCCCTGGACAGG - Intergenic
901930800 1:12595409-12595431 GGCCGCGGGGGTCCCGGGAGGGG + Intronic
902289676 1:15427910-15427932 TGCCGCTGGGCTCCCCGGACAGG + Intronic
902466913 1:16624181-16624203 TGCCCCTGGGGGCCCGTGCCTGG + Intergenic
903027669 1:20441194-20441216 CACAGCTGGGGGCTCGGGAGAGG - Intergenic
903628206 1:24745931-24745953 CGGCGCTGGGGCCCCGGGGCAGG - Intronic
904038222 1:27570075-27570097 ACCCGCTGGGGGCCCAGGAATGG - Intronic
904807777 1:33143756-33143778 CACCCCTGGGAGCCCAGGACTGG - Intergenic
904824769 1:33266995-33267017 CCCCGCTGGGGCCCCTGGATGGG + Intronic
905617217 1:39409284-39409306 GGCGGCTGCGGGCCGGGGACTGG + Intronic
906140695 1:43531843-43531865 CGGCGATGGGGAGCCGGGACGGG - Intronic
906532825 1:46533221-46533243 GGCCGCGGCGGGCCCGGGCCAGG - Intergenic
909739134 1:79006703-79006725 TGCGGCTGTGGACCCGGGACCGG + Exonic
911078862 1:93908998-93909020 CGCCGCGGGGCTCCCGGGGCAGG - Intronic
911176182 1:94820421-94820443 CGCCGGCGGGGGCCGGTGACTGG - Exonic
912471681 1:109911075-109911097 CGCGGCGCTGGGCCCGGGACGGG + Intronic
912492715 1:110070734-110070756 CGCCGCGGGGGGCGGGGGGCGGG + Intronic
914803229 1:150974959-150974981 CGCGGCTGTGGGGCCGGGAGCGG - Exonic
917974606 1:180230683-180230705 CGCCGCTCAGGGGCCGGGAGGGG + Intronic
921850517 1:219928448-219928470 CGGCGCCGGGCGCCCGGGGCTGG - Exonic
922167672 1:223129390-223129412 CGCTGCTGAGGGCCAGGGCCTGG - Intronic
922472870 1:225887663-225887685 CGCCGCTTGAGGGCGGGGACTGG + Intronic
922480883 1:225939634-225939656 CGCCGCTTGAGGGCGGGGACTGG + Intronic
922602918 1:226870698-226870720 CGGCGCTGAGGGCCCGGGGTGGG + Intronic
922807397 1:228397484-228397506 CGCCTCTGGGTGCCAAGGACAGG + Intronic
922917709 1:229271536-229271558 GGCCGCTGGGGGCTCGGGTGGGG + Intronic
923119622 1:230978489-230978511 CGGGGCTGGGGTCCCGGGCCGGG - Intronic
923622231 1:235588349-235588371 CCCCGCTGGGGGCCAGGTCCAGG - Intronic
1062798355 10:361002-361024 CGAAGCTGGGGCCCCGGGGCAGG + Intronic
1063676034 10:8141262-8141284 CGCTGGTGGGGTCCCGGGGCAGG + Intergenic
1064418011 10:15167925-15167947 CGCCGAGGGGGTCCCGGGCCCGG - Intronic
1069386258 10:67885228-67885250 GGCGGCTGGGGGCTCGGGGCAGG + Intronic
1070954384 10:80454625-80454647 AGCCGCGGCGGGCCCGGGGCCGG + Intronic
1071847550 10:89535769-89535791 CGCAGCCTGGGGCCCGGGAAGGG - Intronic
1072582367 10:96750500-96750522 TGCGGCTGGGGGCCCGGAAGTGG - Intergenic
1073253130 10:102133813-102133835 CGGGGCTGGAGGCCCGGGCCGGG + Intronic
1076340146 10:129739970-129739992 GGCCACTGGGGGCCCAGGATGGG + Intronic
1076433233 10:130422213-130422235 CTCTGCTGGGGGCTGGGGACAGG - Intergenic
1076724018 10:132405069-132405091 CGCGGCTGGGGGTCCGGGGCTGG - Exonic
1076865762 10:133165473-133165495 CCCCGCAGGGGGACGGGGACCGG + Intronic
1076999631 11:316129-316151 GGCCGCTGCGGGCCTGGCACGGG - Intergenic
1077090753 11:777267-777289 GGCCGCTGGGGGCGCCGGGCAGG - Intronic
1077170701 11:1164692-1164714 AGCCTCAGGGGGCCCAGGACAGG - Intronic
1077170754 11:1164854-1164876 AGCCTCAGGGGGCCCAGGACAGG - Intronic
1077170811 11:1165016-1165038 AGCCTCAGGGGGCCCAGGACAGG - Intronic
1077485897 11:2838324-2838346 TGGGGCTGGGGGCCAGGGACCGG + Intronic
1079136599 11:17779140-17779162 CCCTGCTTGGGGCCCGGGGCCGG + Intronic
1082807491 11:57460194-57460216 CGCGGCTGGGGGCGGGGGAGGGG + Intergenic
1083428691 11:62602534-62602556 GGGCGCTGGGGGCGCGGGGCCGG - Exonic
1083618048 11:64036034-64036056 CGCCCAGGGGGGCCCGGGAGAGG - Intronic
1083779379 11:64910097-64910119 TGGAGCTGGGGGCCCTGGACCGG - Exonic
1084041550 11:66545851-66545873 CGCCGCTGGGACCCCTGGCCCGG - Exonic
1084063758 11:66691763-66691785 CGCTGCATGGGGGCCGGGACAGG + Intronic
1084180562 11:67443583-67443605 CGGCGCCGGGGGGCCGGGAGCGG + Intronic
1084462279 11:69302633-69302655 AGCCGCTGGGAGCCTGGCACGGG + Intronic
1092247702 12:6872768-6872790 CGCCGCTGGGCCCCCAGGTCAGG + Exonic
1094375422 12:29783804-29783826 CGCCGCCGGGGCCCCGGTAGGGG - Exonic
1094528792 12:31252366-31252388 TGCGGCTGGGGGCCCGGAAGTGG + Intergenic
1096106553 12:48999500-48999522 CGCCCCCTGGGGCCCGGGATTGG + Intergenic
1097281311 12:57846652-57846674 TGCCGCTGGGGGATCGGGGCCGG - Exonic
1097990373 12:65826013-65826035 CGCCGGAGGGAGCCCGGGGCAGG + Intronic
1101340924 12:103841292-103841314 CGCCGCTGCGGGGCGGGGAGTGG + Intergenic
1102453323 12:113056981-113057003 TCCCGCTGGGGGCCCGCGAGCGG + Intronic
1102997310 12:117360661-117360683 CGCGGCTGGGGGCCCGAGGCTGG - Intronic
1103309127 12:119990050-119990072 CGCTGCTGGCGGCCGGGGAGCGG + Exonic
1103927160 12:124429437-124429459 CGCCCCTGCAGGCCTGGGACGGG + Intronic
1104697275 12:130872504-130872526 GGGCGCTGGGGGCGCGGGAGCGG + Intronic
1108541503 13:51451742-51451764 CGCCGCTGCCGGGCCGGGCCGGG + Intronic
1108828126 13:54441081-54441103 CGCGGCTGGGAGCCCGGAAGTGG + Intergenic
1110775702 13:79405980-79406002 CCGGGCTGGGGGCCGGGGACGGG - Exonic
1117337412 14:54767007-54767029 CGTGGCTGGGGGCCCCGGTCAGG + Intronic
1117441725 14:55766389-55766411 TGCGGCTGGGGGCCCGGAAGTGG - Intergenic
1117690396 14:58299352-58299374 CGCCACCGCGGGCCCGGGGCGGG + Intronic
1118854746 14:69612013-69612035 CGCCGCTGGGAGCCCCGCGCTGG + Intronic
1119701879 14:76761397-76761419 CGCCGCGGGGGGCGGAGGACTGG + Intergenic
1121648149 14:95535126-95535148 CTCCGCTGGGGGCGCGGCGCGGG + Exonic
1122075381 14:99231814-99231836 CGCCTCTGGGGGCCTGGTGCAGG + Intronic
1122688678 14:103521635-103521657 GGCCGCTGTGGGCGCGGGGCTGG + Intronic
1123004595 14:105315118-105315140 CTCCGCTGGGGGACCCGGGCCGG - Exonic
1124917528 15:33990649-33990671 CGGCTCTGGGGGCCTGGGACCGG + Intronic
1125834446 15:42737144-42737166 CGCCGCGGGCGGCCAGGGAGGGG + Intergenic
1126099703 15:45111796-45111818 AGCCGCTGGGACCCCGAGACCGG - Exonic
1126103829 15:45135241-45135263 AGCCGCTGGGACCCCGAGACCGG + Exonic
1127763633 15:62164594-62164616 CGCAGCTGTGGGCCCGGGGCCGG + Exonic
1128151589 15:65366673-65366695 AGCCGGTGGGGGGCCAGGACTGG - Intronic
1128344070 15:66842667-66842689 CGAGTCTGGGGGCCCGGGGCGGG + Intergenic
1128780254 15:70354442-70354464 CCCCGCTGTGGGCCTGGGCCCGG + Intergenic
1132043818 15:98547873-98547895 CCCCGCTGGGGGCATGGGGCTGG + Intergenic
1132079562 15:98852647-98852669 CTCCGGTGGGGCCCCGGGGCTGG - Intronic
1132514681 16:360648-360670 CGCGGCTGGGGGCCTGGGCCGGG - Intergenic
1132542259 16:516036-516058 GGCCACGGGGTGCCCGGGACAGG - Intronic
1132570639 16:642454-642476 CCCCGCTGGGGGCCCGGGCCCGG - Intronic
1132683573 16:1153335-1153357 AGGCGCTGGGGGCCGGGGCCGGG + Exonic
1132683592 16:1153369-1153391 AGGCGCTGGGGGCCGGGGCCGGG + Exonic
1132744135 16:1429705-1429727 AGGAGCTGGGGGCTCGGGACAGG + Intergenic
1132810422 16:1794263-1794285 CGCCCCTGGGGTCACGGGAGAGG - Intronic
1132828957 16:1918331-1918353 CGCCGCTCCAGGCCCGGGAGCGG + Exonic
1133287553 16:4697650-4697672 TGCCGGTGGGGACCCGGGTCTGG + Intronic
1133303258 16:4795693-4795715 AGCCTCTGGGGGACCGGGGCAGG + Exonic
1135382701 16:22008019-22008041 GGCGGCTGGGGAGCCGGGACCGG + Intronic
1136394963 16:29987654-29987676 CGCCGCCGGGGCCCAGGGACGGG - Exonic
1137426436 16:48384960-48384982 CGCCCCTGGAGCCCCGGGCCCGG - Intronic
1138345078 16:56315712-56315734 TGCCTCTGGGGGCCCAGGACAGG + Intronic
1141389100 16:83649595-83649617 AGCCGGTGGGAGCCAGGGACTGG + Intronic
1141735383 16:85848605-85848627 GGGGGCTGGGGGCCGGGGACAGG + Intergenic
1142231560 16:88902505-88902527 AGGCGCTGGTGGGCCGGGACTGG + Intronic
1142262175 16:89048144-89048166 CGCTGCTGGGGGCCAGGGCTGGG + Intergenic
1142696525 17:1636912-1636934 GGGCGCTGGGGGCCGGGGTCTGG - Intronic
1142808588 17:2384848-2384870 CGATGCTGGGGGACAGGGACGGG + Exonic
1143480409 17:7224741-7224763 AGCCGCAGGGGGCCTGGGCCTGG + Intronic
1143485372 17:7251316-7251338 GGCCGCGGGGGCCCCGGGGCCGG - Exonic
1144500932 17:15786416-15786438 CCCCGCTGGGGGCGGGGGCCGGG + Intergenic
1144682782 17:17206368-17206390 GGCCGCTGGCGGCGCGTGACGGG - Intronic
1144960576 17:19042031-19042053 CAGGGCTGGGGGCCTGGGACAGG + Intronic
1144974584 17:19132493-19132515 CAGGGCTGGGGGCCTGGGACAGG - Intronic
1145163092 17:20589078-20589100 CCCCGCTGGGGGCCGGGGCCGGG + Intergenic
1147608170 17:41785917-41785939 CGCCGGTGGGAGCCCGGCTCTGG - Intronic
1147754756 17:42761096-42761118 CGACGCTCGGGGCCCGCGGCTGG - Intronic
1150108555 17:62479008-62479030 GGCCGCGGGGGGCGCGGGACCGG - Exonic
1150217105 17:63476966-63476988 CGCCGCTGGGGACTCTGGAGCGG + Intergenic
1152245489 17:79182886-79182908 GGCCGCTGGGGACTCGGGGCGGG - Intronic
1152319596 17:79601052-79601074 CTCCGCAGGGGCCCCGGGGCGGG - Intergenic
1152633512 17:81421147-81421169 GGCAGCTGGGGGCCAGGGAGGGG - Intronic
1152683411 17:81681924-81681946 TGCAGCTGGGGGTCCGGGGCAGG - Intronic
1152687771 17:81703067-81703089 CGGCACTGGGGGCCCGGAGCGGG + Intronic
1153688307 18:7567590-7567612 CGCCGAGTGGGGCCAGGGACAGG + Exonic
1154940794 18:21111379-21111401 CGCCGCTCGGGCCACGGGCCGGG + Exonic
1157529585 18:48409676-48409698 CGGCGGGGGGCGCCCGGGACTGG + Intronic
1159040650 18:63320309-63320331 CGCCGCGGCAGGCCCGGGAGTGG + Intergenic
1160383386 18:78477983-78478005 CGCAGCTGGGGGCAAGGAACGGG - Intergenic
1160590830 18:79943936-79943958 TGCCGCTTGGGGCCTGGGAGAGG - Intronic
1160767227 19:813965-813987 TGCCGCGGGGGGCTCTGGACCGG + Intronic
1160787705 19:908920-908942 CGCCGCTGTGGGCCGGTCACAGG - Intronic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1161951867 19:7471903-7471925 CGTCGCTGATGGCCAGGGACCGG - Exonic
1162070500 19:8149523-8149545 CGGCGCCGGGGACCCGGGGCGGG + Exonic
1162312087 19:9913746-9913768 CGGGGCAGGGGGTCCGGGACGGG + Intronic
1162727065 19:12696145-12696167 CGGGGCCGGGGGCCGGGGACCGG - Intronic
1163546073 19:17942221-17942243 AGCCTCTGGGGGCCAGGGAGGGG - Intronic
1163596169 19:18222216-18222238 CGCCGCTGGCTGTGCGGGACTGG + Exonic
1163611891 19:18305976-18305998 AGCAGTTGGGGGCCCGGGCCTGG - Intergenic
1163782707 19:19258646-19258668 CGCCGCAGGGCTCCCGGGGCCGG + Exonic
1165139577 19:33690645-33690667 CACCTGTGGGGGCCCGGCACAGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1165493680 19:36140096-36140118 CGCTGCGGGAGGCCCGGGAGCGG + Exonic
1165809993 19:38606285-38606307 CTGGGCTGGAGGCCCGGGACTGG + Intronic
1165943677 19:39428605-39428627 CGCCGCTGGGAGCCTGGGCCAGG - Intergenic
1166723643 19:45012127-45012149 TGCGGCTGCGGGCCCGGGCCCGG - Exonic
1166782888 19:45351558-45351580 CGCCGCTGGGAACCAGGGCCAGG + Exonic
1167077047 19:47256588-47256610 CGCCGCGGGGTCTCCGGGACAGG + Exonic
1167103815 19:47419274-47419296 CCCCGCTGGGGGCGGGGGCCGGG - Exonic
1167437906 19:49490533-49490555 TGCGGCTGGGGGCCCGGAAGTGG - Exonic
1167594532 19:50419983-50420005 GGCCCCTGGGGGCCAGGGAGGGG + Intronic
1167643644 19:50694924-50694946 CGCCGCCGGGGCCCCAGGGCTGG + Intronic
1167771810 19:51525488-51525510 CTGTGCTGGGGGCCCGGGTCAGG - Intronic
1168102461 19:54148411-54148433 GGACGCTGGGGGGCCGGGGCTGG - Exonic
1168124709 19:54277108-54277130 CCTGGCTGGGGGCCCGGGGCAGG - Intronic
1168300363 19:55401534-55401556 GGCCCCAGGGGGCCCGGGAGGGG - Exonic
1168719034 19:58544802-58544824 CGCCTCTGGCAGCCCGGGCCCGG + Exonic
926027367 2:9556320-9556342 CGGGGCTCGGGGCCCGGGGCCGG - Intergenic
926581441 2:14634975-14634997 CGCCGCCGGTGGCCCGGGCCCGG + Exonic
926801781 2:16665747-16665769 CGCGGCTGGGGGCGCGGCAGGGG - Intronic
927667457 2:25042338-25042360 CGCCCCCGCGGGCCCGGGCCCGG - Intronic
927937967 2:27086118-27086140 TGCCGCTGCGGGCCCGGGTGCGG - Exonic
931429548 2:62197199-62197221 CGGGGCTGCGGGCGCGGGACTGG + Intronic
931671564 2:64653367-64653389 AGCCGCTGGGGGGCAGGGCCGGG - Intronic
932191075 2:69741984-69742006 CGCACCTGGGGCCCCGGGCCGGG - Exonic
934460082 2:94209124-94209146 CACTGCTGGTGGCCTGGGACGGG + Intergenic
934736446 2:96692054-96692076 AGCCGCTGGGGTCCTGGGGCAGG + Intergenic
935592469 2:104855358-104855380 GGCCGGCGGGGGCCCGGGGCGGG + Intergenic
937995989 2:127695542-127695564 GGCCGGCGGGGTCCCGGGACAGG + Intergenic
940640756 2:156342373-156342395 AGCCGCCGGGGGCCGGGGGCCGG - Intergenic
940830287 2:158457850-158457872 CGGCGCTGGGGAGCCGGGAGGGG - Intronic
940954376 2:159712229-159712251 GGGCGCTGGAGGCCCGGGCCGGG - Intergenic
942775109 2:179572009-179572031 CGCCTGTGGGGGCCTGGGAGTGG + Intronic
946235669 2:218323192-218323214 CCCCGCGGGGGGCCGGGGCCGGG + Intronic
946339190 2:219057404-219057426 CGCCGCCGGGGGGCTGGGCCCGG - Intronic
946370654 2:219279520-219279542 TGCGGCCGGGGGCCCGGGTCAGG + Intronic
946747482 2:222860883-222860905 CGGCGCTGGCGGCCCGGGGCGGG - Intergenic
948645356 2:239400820-239400842 CGCCGCCGGGGGCCCAGGCTGGG + Exonic
1172284742 20:33732409-33732431 CGGCGCGCGGGGCCCGGGACGGG + Intronic
1174123700 20:48287315-48287337 AGCAGCCAGGGGCCCGGGACAGG - Intergenic
1176380514 21:6110400-6110422 CGCCGCTGAGGGCCGGGGCCGGG + Intergenic
1176550273 21:8217868-8217890 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176568952 21:8400070-8400092 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1176569201 21:8400906-8400928 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1176576866 21:8444305-8444327 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1176577115 21:8445138-8445160 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG + Intergenic
1179742958 21:43427840-43427862 CGCCGCTGAGGGCCGGGGCCGGG - Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180064332 21:45405126-45405148 CGCCGCTGGGAGGCCGGGCAGGG - Intronic
1181064479 22:20299115-20299137 CGCGGCTGGGAGCGCGGGGCGGG + Intergenic
1183393696 22:37560296-37560318 CGCGGCTGGGGGGCCAGGCCAGG - Intergenic
1183606888 22:38871430-38871452 CGGGGCTGGGGGCCCGAGAGGGG + Intronic
1183649725 22:39146939-39146961 AGGGGCTCGGGGCCCGGGACAGG - Intronic
1184557280 22:45240286-45240308 CGGTGCTGAGGGCCCGGGGCGGG + Intronic
1185316167 22:50180132-50180154 CGCGGCGGGGGGCCCGGGTGGGG - Exonic
1203255168 22_KI270733v1_random:134206-134228 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203263224 22_KI270733v1_random:179285-179307 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
952253799 3:31678449-31678471 CACCGCTGGTGGTCGGGGACAGG + Intronic
953035102 3:39204173-39204195 AGCCGTTGGGGGGCCGGGCCAGG + Intergenic
954367439 3:50154191-50154213 CTCCGCAGGGTGCCCGGGGCAGG + Intergenic
961780178 3:129316444-129316466 CGCAGCGGGGCGCCCCGGACAGG + Intergenic
968088374 3:195884937-195884959 CGCCCCTGGGGGCCCAGCAGGGG - Exonic
968114943 3:196082131-196082153 CCCCCCTGGGGGCCGGGGGCGGG - Exonic
968433962 4:575720-575742 CGCGGCCGGGGCCCCGGGGCCGG - Intergenic
968661879 4:1802052-1802074 CGCCGCTGGGGCTCCTGGGCTGG + Intronic
968903576 4:3442024-3442046 CCCCGGTGGGGGCCAGGGGCTGG - Exonic
969122434 4:4920119-4920141 CGCCGCTGGTTGCCCAGGCCAGG + Intergenic
969255590 4:5999633-5999655 CACAGCTGGTGGCCAGGGACTGG + Intergenic
969417298 4:7068983-7069005 CCCCGCTTGGGGGCCGGCACCGG - Intergenic
969674669 4:8608143-8608165 CGCAGCTGGGGGCTGGGGGCTGG - Intronic
969706432 4:8794676-8794698 CACCGCTGGGGGACCAGCACCGG - Intergenic
971421954 4:26481737-26481759 CGCCCCTGGGGGACCAGGATTGG + Exonic
971439704 4:26668420-26668442 CCCTGCTGAGGGCCAGGGACTGG + Intronic
972312091 4:37891207-37891229 CGCCGCGGGGGGACGGGGAGGGG - Exonic
972740238 4:41881161-41881183 CGCCGTTGGGGGCCGGGGTGCGG - Intergenic
977694345 4:99949939-99949961 CGCCGCTGGGGGCCGGCGGGCGG - Intronic
985580543 5:693420-693442 GGACGCTGGGGGCCGGGGGCGGG - Intergenic
992106336 5:73451603-73451625 CGGCTGCGGGGGCCCGGGACTGG + Intergenic
992796107 5:80256148-80256170 CGCCGCCGGGCGCCCGGGAAGGG - Intergenic
995764591 5:115602047-115602069 CGCCGCCGGGGGCGCGGGGTGGG - Intronic
997984602 5:138492340-138492362 CGGCGCGGGAGGCGCGGGACGGG + Intergenic
998160136 5:139808622-139808644 CTCTGATGGGGGCCCGGGAGTGG + Intronic
1001984223 5:176060640-176060662 CGCTGCTGGGGACGCGGGCCTGG - Intronic
1002029403 5:176416661-176416683 CGCAGCGCTGGGCCCGGGACCGG + Intergenic
1002233252 5:177783425-177783447 CGCTGCTGGGGACGCGGGCCTGG + Intronic
1002262726 5:178006356-178006378 CGCTGCTGGGGACGCGGGCCTGG - Intergenic
1005959474 6:30685503-30685525 GGCCTCTGGAGGCTCGGGACTGG - Exonic
1005959513 6:30685653-30685675 GGCCTCTGGAGGCCCGGGAGCGG - Exonic
1006640299 6:35486140-35486162 CGCCGGTCGAGGCCCGGAACGGG - Intronic
1006829034 6:36957906-36957928 GGGCGCTGGGGGCCAGGGTCAGG - Intronic
1007407607 6:41643978-41644000 TGCCTCTGGGGGCCAGGGTCCGG + Intronic
1007633440 6:43285078-43285100 CGGCGCTGGGGGCCTGGCTCCGG - Exonic
1008520986 6:52362258-52362280 CGCCGCGGGAGGCGCGGAACGGG + Intronic
1008921021 6:56843941-56843963 CGCCCTTGGGGATCCGGGACCGG - Intronic
1017107369 6:150900544-150900566 GGAAGCTGGGGGCCCGGGTCTGG - Intronic
1017889109 6:158624769-158624791 CGCCCCTGGGGGCGAGGGGCTGG - Intronic
1018844532 6:167546679-167546701 AGCCGCTGGGCGCCCTGGTCAGG + Intergenic
1019216766 6:170448855-170448877 AGTTGCTGGGGGCCAGGGACAGG + Intergenic
1019293082 7:259847-259869 CGCACCTGGAGGCCCTGGACCGG + Exonic
1019323279 7:425160-425182 CGCCCCTGGGGAGCGGGGACCGG - Intergenic
1019559574 7:1649254-1649276 CACAGCTGGGGGCCAGGCACAGG - Intergenic
1023896095 7:44434230-44434252 GGCAGCTGGGGGCCCAGGGCTGG - Intronic
1028622207 7:92836701-92836723 CGGCGCTGGGGGCCCCAGCCGGG + Intergenic
1029640316 7:101816153-101816175 CTCCGCCGGGGGCCCCGGGCTGG + Intronic
1029640772 7:101817461-101817483 CGCCGCGGGGGGACCGTGCCGGG + Intronic
1029667850 7:102007448-102007470 CGCCCCTGGGTGCCAGGGCCTGG + Intronic
1029746411 7:102517781-102517803 CGCCGCAGGGGGGGCGGGCCGGG + Intronic
1032279173 7:130486957-130486979 CGCGGCTGGGGGCCTGGTTCAGG + Intronic
1034262379 7:149765052-149765074 CGCCGCTGTGGGCCCTGGAGTGG + Exonic
1035169531 7:157009933-157009955 CGCCGCTGGGGGCCTGGCGCTGG - Exonic
1035618182 8:1017824-1017846 AGCAGCTGGAGGCCTGGGACAGG - Intergenic
1036432239 8:8702081-8702103 CGCCCCTGGGCGCCCGCGCCCGG + Exonic
1036454190 8:8893381-8893403 CGCCTCGGGGGGCCCGGCTCCGG + Exonic
1039453919 8:37695944-37695966 CGCCGCTGGGGGGGCGGGGAGGG - Exonic
1040981636 8:53251250-53251272 CGCCGCTGGGTGCCAGAGAGGGG + Intronic
1042235867 8:66613026-66613048 CGGCGCTGCGGGCCGGGGTCGGG - Exonic
1045269491 8:100649722-100649744 CGCCGCTCTGGTCCCGGGATAGG + Intronic
1047456414 8:125017208-125017230 AGCTCCTGGGGGCCCAGGACTGG + Intronic
1048554039 8:135457776-135457798 CGCCGCTGGGGGCGCGGGCGGGG + Exonic
1048823393 8:138400013-138400035 CTCTGCAGGGGGCCTGGGACTGG - Intronic
1049082936 8:140457244-140457266 CGCCGCGGACGGCCCGGGAGGGG + Intronic
1049222239 8:141433426-141433448 AGACGCTGGGGGCCCGAGGCTGG + Intergenic
1049665438 8:143840793-143840815 CGCCGAGGCGGGCCCGGGAACGG - Exonic
1051629256 9:19127364-19127386 CGCCGCTGGGGGCCCGGGACCGG + Intronic
1054274240 9:63052692-63052714 CACTGCTGGTGGCCTGGGACGGG - Intergenic
1054301832 9:63385774-63385796 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054400601 9:64712277-64712299 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054434207 9:65196592-65196614 CACTGCTGGTGGCCTGGGACGGG + Intergenic
1054496182 9:65825088-65825110 CACTGCTGGTGGCCTGGGACGGG - Intergenic
1056992336 9:91423699-91423721 CGGCGCTCGGGGCTCGGGCCGGG + Exonic
1057881532 9:98796306-98796328 CGCCGCTGCGGCCCCGGGCCCGG + Exonic
1060480801 9:124015879-124015901 CGCGGCTGAGGGCCGGGAACTGG + Intronic
1061008445 9:127941728-127941750 CCCAGCTGGGGGGCCGGGATGGG - Exonic
1061084985 9:128393323-128393345 CGCCTCTGGCGGCTCGGGGCCGG + Intergenic
1061262727 9:129488817-129488839 CACCGCTGGGGGCCGAGGGCAGG + Intergenic
1061848280 9:133400332-133400354 AGCCTCTGGGGGCCCTGGTCGGG + Intronic
1062130082 9:134887859-134887881 CGAGGCTGGGGGCCTTGGACAGG - Intergenic
1062493660 9:136821647-136821669 CGCGGCGGGAGGCCCGAGACGGG - Intronic
1062507535 9:136885955-136885977 CGCCGCTCTGCGCCCGGCACCGG + Intronic
1062571767 9:137189026-137189048 CGGCGCTGTGGGCCCAGGGCAGG - Intronic
1062618079 9:137407110-137407132 CGGCGTGGGGTGCCCGGGACTGG - Intronic
1203471317 Un_GL000220v1:116507-116529 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1203471566 Un_GL000220v1:117343-117365 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1203479138 Un_GL000220v1:160479-160501 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1203479387 Un_GL000220v1:161315-161337 CCCCGCGAGGGGCCCGGGGCGGG + Intergenic
1186768187 X:12791889-12791911 CACCGCTGGGAGGCCGGGAGCGG - Intronic
1194781376 X:98028836-98028858 CGAGGCTGGGGTCCCGGGAGAGG + Intergenic
1195216887 X:102712134-102712156 GGCGGCTGGGGGCCCGGGCAGGG - Intergenic
1195710755 X:107772119-107772141 CGAAGCTGGGAGCCAGGGACAGG + Intronic
1198270551 X:135052184-135052206 CGAGGGTGGGGGCCCGGGCCGGG + Intronic
1198827263 X:140712777-140712799 CTTCGTTGGGGGCCCGGGAGAGG - Intergenic
1199772660 X:150984197-150984219 CGCCGCTGCGGGCCCTGGAGCGG + Intronic
1200092381 X:153642135-153642157 CGGCGCTTGGGGCGCGGGAGTGG - Intergenic
1200141808 X:153906245-153906267 CGCCGCAGGGGACGCCGGACAGG + Exonic