ID: 1051635403

View in Genome Browser
Species Human (GRCh38)
Location 9:19176857-19176879
Sequence CACTTAAACCCGGGGGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051635396_1051635403 8 Left 1051635396 9:19176826-19176848 CCAGCTACTTGGGAGGCTGAGGC 0: 81212
1: 190903
2: 234468
3: 228974
4: 272812
Right 1051635403 9:19176857-19176879 CACTTAAACCCGGGGGGTGGAGG No data
1051635393_1051635403 17 Left 1051635393 9:19176817-19176839 CCTGTAATTCCAGCTACTTGGGA 0: 2980
1: 56977
2: 153098
3: 260534
4: 534244
Right 1051635403 9:19176857-19176879 CACTTAAACCCGGGGGGTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051635403 Original CRISPR CACTTAAACCCGGGGGGTGG AGG Intergenic
No off target data available for this crispr