ID: 1051641791

View in Genome Browser
Species Human (GRCh38)
Location 9:19230639-19230661
Sequence GAGGGGCGCCGCCTACAGCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 136}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051641791_1051641804 22 Left 1051641791 9:19230639-19230661 CCTGGCTGTAGGCGGCGCCCCTC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1051641804 9:19230684-19230706 CGCAGGCGCAGACCGGACTGAGG 0: 1
1: 0
2: 0
3: 2
4: 66
1051641791_1051641805 25 Left 1051641791 9:19230639-19230661 CCTGGCTGTAGGCGGCGCCCCTC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1051641805 9:19230687-19230709 AGGCGCAGACCGGACTGAGGCGG 0: 1
1: 0
2: 0
3: 7
4: 107
1051641791_1051641806 28 Left 1051641791 9:19230639-19230661 CCTGGCTGTAGGCGGCGCCCCTC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1051641806 9:19230690-19230712 CGCAGACCGGACTGAGGCGGCGG 0: 1
1: 0
2: 0
3: 10
4: 93
1051641791_1051641803 15 Left 1051641791 9:19230639-19230661 CCTGGCTGTAGGCGGCGCCCCTC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1051641803 9:19230677-19230699 GAGGCGGCGCAGGCGCAGACCGG 0: 1
1: 0
2: 4
3: 201
4: 311
1051641791_1051641799 5 Left 1051641791 9:19230639-19230661 CCTGGCTGTAGGCGGCGCCCCTC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1051641799 9:19230667-19230689 CCCTGCCCGCGAGGCGGCGCAGG 0: 1
1: 0
2: 4
3: 20
4: 187
1051641791_1051641797 -1 Left 1051641791 9:19230639-19230661 CCTGGCTGTAGGCGGCGCCCCTC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1051641797 9:19230661-19230683 CGGAGACCCTGCCCGCGAGGCGG 0: 1
1: 0
2: 0
3: 9
4: 115
1051641791_1051641796 -4 Left 1051641791 9:19230639-19230661 CCTGGCTGTAGGCGGCGCCCCTC 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1051641796 9:19230658-19230680 CCTCGGAGACCCTGCCCGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051641791 Original CRISPR GAGGGGCGCCGCCTACAGCC AGG (reversed) Exonic