ID: 1051643225

View in Genome Browser
Species Human (GRCh38)
Location 9:19243014-19243036
Sequence CAAGATACCCCCCTTTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 51}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051643225 Original CRISPR CAAGATACCCCCCTTTAAAT TGG (reversed) Intronic
900921729 1:5676523-5676545 CAAGACATCCCCCATTAAAGAGG + Intergenic
902525109 1:17052145-17052167 CAAGATACACACTTTTAAGTAGG + Intronic
915657902 1:157376751-157376773 GAAGATACTCCCCTATTAATAGG + Intergenic
915671156 1:157490211-157490233 CAAGATACTCCCCATTAATAAGG + Intergenic
1067161495 10:43828703-43828725 CCAGATCCCTCCCTTTAAAGAGG - Intergenic
1081318049 11:41655772-41655794 AAAAATACCCCCTTGTAAATTGG + Intergenic
1104503111 12:129304594-129304616 CAAGATGCCGCCGTATAAATGGG - Intronic
1111816406 13:93159253-93159275 CAAGATAACCCACTTAAAAATGG - Intergenic
1123396284 15:19940772-19940794 CCAGATACACCCCTTTGAAATGG - Intergenic
1128553154 15:68611351-68611373 CAAGGTACCACCCTTTGCATTGG + Intronic
1133386934 16:5377336-5377358 CAAGAAAGCCCCCTTGAGATGGG + Intergenic
1137898080 16:52235766-52235788 GAAGAAACCCCTCTTTAATTGGG - Intergenic
1138939943 16:61777991-61778013 CTAGATCCCCCACTTTAGATAGG - Intronic
1140611127 16:76600359-76600381 AATGATTCCCCCATTTAAATAGG - Intronic
1149914207 17:60593600-60593622 CAAGCTTCCTCTCTTTAAATAGG + Intergenic
1151018208 17:70581655-70581677 CAAGAAACCACCGATTAAATCGG + Intergenic
1154023924 18:10689034-10689056 CAAAATACCCTCCTTGAAAAAGG - Intronic
1156010543 18:32492580-32492602 GAAGATACCCATTTTTAAATGGG - Intergenic
1158265639 18:55658068-55658090 CAAGTTAGCCCCATTCAAATTGG - Intronic
930349108 2:50226718-50226740 CAAGATACCAATCTATAAATAGG + Intronic
933133162 2:78698648-78698670 GAAAATATGCCCCTTTAAATAGG + Intergenic
945565615 2:211395159-211395181 CAAGATAGTCCACTTTAAAAAGG - Intronic
945886787 2:215384299-215384321 CAAGATAGCGCTCTTTAAAAGGG - Intronic
946516399 2:220416274-220416296 TAAGATACCCCACTCTAATTAGG + Intergenic
947467285 2:230362409-230362431 CAACATCCCCACATTTAAATGGG - Intronic
1171978998 20:31613554-31613576 CAAGATCTCCTCCTTTAAAAGGG - Intergenic
1175574072 20:60047307-60047329 CAAGATACTCACCTATAAAATGG - Intergenic
1177937609 21:27368606-27368628 CAAGTTTCCCAGCTTTAAATAGG - Intergenic
1178881920 21:36456548-36456570 CCTCATACCTCCCTTTAAATAGG - Intergenic
1184028666 22:41877677-41877699 CACGATATCCTCCTTCAAATAGG - Intronic
961205355 3:125077085-125077107 CAGGATACCCCCTATTATATAGG + Intergenic
962276165 3:134015255-134015277 CAAGATTTCCCCCTTTTAAAAGG - Intronic
963684949 3:148421605-148421627 CAAGAAACTCCCCCTTAAATTGG - Intergenic
966300715 3:178476678-178476700 CAAGCTACTCCCCTTGAAATAGG + Intronic
969213200 4:5703866-5703888 CAACATAACCCCATTTAAAATGG - Intronic
969506631 4:7591998-7592020 AAAAAAATCCCCCTTTAAATTGG + Intronic
971483882 4:27140087-27140109 CTAGATTCCCTGCTTTAAATGGG + Intergenic
973946602 4:55962928-55962950 CCATATACCCACCTTTACATTGG + Intronic
975115342 4:70674224-70674246 CTAGATACTACTCTTTAAATAGG - Intronic
977747289 4:100564622-100564644 CAACAGACCCCCCTTTCATTTGG + Intronic
987145734 5:14989567-14989589 CAAGTTACCTGCCTATAAATTGG - Intergenic
994406117 5:99346896-99346918 CAATATACCCCACCATAAATAGG - Intergenic
999633004 5:153590938-153590960 CACAATACCCCCATTTAAAGGGG - Intronic
999910791 5:156196270-156196292 CAAGAATCCTCCCTTTATATGGG - Intronic
1010357378 6:74949570-74949592 CAAGATTCCCACCTTCATATTGG + Intergenic
1016257008 6:142119317-142119339 CAGGATACCCCCATCTAAATAGG + Intergenic
1016832083 6:148444214-148444236 CCAGATACCTCCCTTAGAATAGG - Intronic
1020736834 7:11960780-11960802 CCATATAATCCCCTTTAAATTGG + Intergenic
1020842099 7:13231327-13231349 AAAGACAATCCCCTTTAAATTGG + Intergenic
1028510522 7:91620532-91620554 CAGTATACCCACCTTTAACTGGG - Intergenic
1039657984 8:39431112-39431134 AAAAATAACCCCATTTAAATTGG - Intergenic
1039784075 8:40817056-40817078 TAAGATACCCACCATTAAATTGG + Intronic
1041895824 8:62923852-62923874 CAAGATTCCATCCCTTAAATAGG + Intronic
1051643225 9:19243014-19243036 CAAGATACCCCCCTTTAAATTGG - Intronic
1061543864 9:131292467-131292489 CAATTTCCCCCTCTTTAAATGGG - Intronic
1187637423 X:21245708-21245730 CTAAATACCCCACTTAAAATTGG + Intergenic