ID: 1051650279

View in Genome Browser
Species Human (GRCh38)
Location 9:19316663-19316685
Sequence CAATTGAAGCAGATTTCTCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 153}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051650277_1051650279 15 Left 1051650277 9:19316625-19316647 CCAAAAAACTCAAGAAGGCTCAG 0: 1
1: 0
2: 0
3: 18
4: 189
Right 1051650279 9:19316663-19316685 CAATTGAAGCAGATTTCTCCTGG 0: 1
1: 0
2: 2
3: 9
4: 153
1051650275_1051650279 29 Left 1051650275 9:19316611-19316633 CCTTTGTTAGTTCACCAAAAAAC 0: 1
1: 0
2: 0
3: 15
4: 144
Right 1051650279 9:19316663-19316685 CAATTGAAGCAGATTTCTCCTGG 0: 1
1: 0
2: 2
3: 9
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051650279 Original CRISPR CAATTGAAGCAGATTTCTCC TGG Exonic
900843253 1:5073993-5074015 AAATTGAAGCACATTTTCCCTGG + Intergenic
901391220 1:8947531-8947553 CAAGTGAAGCAGAATGCCCCAGG - Intronic
901415488 1:9113354-9113376 CCCTTGAAGCACAGTTCTCCTGG - Intronic
903442852 1:23401469-23401491 AGATCCAAGCAGATTTCTCCTGG + Intronic
904953748 1:34266003-34266025 CAATTAAAGCAGAATCCTCAGGG - Intergenic
905429696 1:37912633-37912655 CCATTGTAGCGGATATCTCCTGG + Intronic
906543669 1:46606871-46606893 CAATAGATGCAGATGTCTACTGG + Intronic
906806751 1:48786702-48786724 CTGTTGAAGCAGATTTCTACTGG + Intronic
906812286 1:48840188-48840210 CAATTAAAGCCCACTTCTCCTGG + Intronic
910187086 1:84555753-84555775 CTATTGAATCAGAATTCTCCAGG + Intronic
910685211 1:89909135-89909157 CAATTAAGGCAGATTTCACTGGG + Intronic
912488040 1:110044716-110044738 CAATTATAGGAGACTTCTCCTGG + Intronic
914698535 1:150108634-150108656 CAATTGAAGAAGGTATATCCAGG + Intronic
915386187 1:155494980-155495002 CAAATGAAGCACATATTTCCAGG + Intronic
917064573 1:171077590-171077612 CACTTGAAACAGATGTCTACTGG + Intergenic
917449650 1:175136574-175136596 CAATGGAGGCAGATTCCTTCTGG + Intronic
918691983 1:187492312-187492334 TCATTGAAGCAGATCTCTCTAGG + Intergenic
918869101 1:189944138-189944160 CAATTGAAGCAGTTTTTTTCAGG + Intergenic
920368062 1:205458552-205458574 TAATCCAGGCAGATTTCTCCAGG + Intergenic
921323645 1:213968920-213968942 GGATTGAATCAGAGTTCTCCTGG - Intergenic
923811573 1:237323848-237323870 CAAATGAAGCTGATGTCTCTGGG - Intronic
924587356 1:245371615-245371637 CATGTGACGCAGATTTCCCCAGG - Intronic
1062983947 10:1749110-1749132 CTATTTAAGAAGATGTCTCCAGG + Intergenic
1065410236 10:25418234-25418256 TAATTGAAAGAGATTTGTCCAGG + Intronic
1065803218 10:29371301-29371323 CAATTCAAGGAGATATCTCAGGG + Intergenic
1070838875 10:79469380-79469402 CAGATGAAGCAGATGTGTCCTGG + Intergenic
1071256515 10:83876701-83876723 CCATTGAACCACATTTCTCAGGG - Intergenic
1072056761 10:91765986-91766008 CAATTGAAGCCAATTTTTCCAGG - Intergenic
1073672541 10:105608208-105608230 CATTTGAAGTAGATTTCTCCTGG - Intergenic
1074006173 10:109426787-109426809 CAATTGAAGCAGATTTGGCCAGG + Intergenic
1074134744 10:110616689-110616711 CAATTGAAGCTACTTTCCCCTGG + Intergenic
1074341423 10:112634128-112634150 CCATTGAAGCATATTTCTTATGG - Intronic
1078498693 11:11846829-11846851 CAATTGCAGCACATTTCCTCAGG - Intronic
1080434243 11:32224970-32224992 CCATTGAAGCAGATTTCCTTAGG - Intergenic
1082258208 11:50055679-50055701 CAATTGAAGCCTTTTTCCCCGGG + Intergenic
1083079739 11:60078239-60078261 CAAGTGAATGAGATTTCTCTGGG - Intergenic
1088336226 11:108707076-108707098 CAATTGTAGCAGATGTATTCTGG - Intronic
1091976254 12:4827923-4827945 CAATTGAAGCAACTTACTCAAGG - Intronic
1092085135 12:5750835-5750857 CAATTGAAGAAGATATTCCCAGG - Exonic
1094125084 12:27014714-27014736 CAATTGAAGGTTATTTCCCCCGG + Intergenic
1094446415 12:30535566-30535588 TAATTCAAGTAGACTTCTCCAGG + Intergenic
1094466892 12:30762999-30763021 CTATTCATGCAGATTTCTGCGGG + Intergenic
1097696209 12:62777128-62777150 CCATTGCAGCAGAGTTCTACAGG - Intronic
1097912799 12:64988858-64988880 CTATTGCTGGAGATTTCTCCAGG - Intergenic
1101236391 12:102794339-102794361 GAATTGAAGATGATTTCTACAGG + Intergenic
1101499208 12:105286322-105286344 CAATTTAACCAGATTTCTATTGG + Intronic
1101883856 12:108644657-108644679 CAATAGAAGCAAAATTCTCTTGG - Intergenic
1105668772 13:22589185-22589207 AAATGGCAGCAGATTCCTCCAGG - Intergenic
1107301670 13:38972374-38972396 CAATTCAAGCAGGTCTCTGCGGG + Intronic
1108740503 13:53332586-53332608 CAATTGAAGCATTAATCTCCAGG + Intergenic
1110131835 13:72020009-72020031 CAATGTAAGCAGGTTTCCCCGGG - Intergenic
1113643279 13:111973593-111973615 CAATGGAAGAAAATTTCACCTGG - Intergenic
1114778519 14:25513770-25513792 TAATTGAATCAGAGTTCTGCAGG + Intergenic
1117117209 14:52526566-52526588 GAATGGAAGCAGATGGCTCCTGG - Intronic
1117783808 14:59261480-59261502 CTGTTGAAGCATATGTCTCCTGG - Intronic
1117984677 14:61375518-61375540 TAATTGACTCAGATTTCTGCAGG + Intronic
1118042046 14:61927894-61927916 CAATTGAATCAACTTTCTCAAGG + Intergenic
1119038249 14:71248752-71248774 TAATTGAAGCAAATAACTCCAGG - Intergenic
1120375925 14:83707091-83707113 CAAAAGAGACAGATTTCTCCTGG + Intergenic
1128593214 15:68921127-68921149 CAATTGAATCAGAATTTTTCAGG - Intronic
1130952801 15:88605581-88605603 CAATTGCAGCAAATAACTCCAGG + Intergenic
1131330416 15:91493488-91493510 CATTTGAAAGATATTTCTCCTGG - Intergenic
1133929914 16:10223723-10223745 CAATTCAATCAGATTTCTGGAGG + Intergenic
1134592935 16:15471325-15471347 CAATTTCTGGAGATTTCTCCTGG + Intronic
1136771374 16:32844728-32844750 CATTGGAAGAAGAATTCTCCTGG - Intergenic
1136899205 16:34016718-34016740 CATTGGAAGAAGAATTCTCCTGG + Intergenic
1137508866 16:49080768-49080790 CAACTGCAGCTGAGTTCTCCAGG + Intergenic
1137576304 16:49602518-49602540 CAGTTTCAGCAGATTCCTCCAGG + Intronic
1138180750 16:54938680-54938702 AAATAAAAGCAGATTTCACCGGG - Intergenic
1203073798 16_KI270728v1_random:1106838-1106860 CATTGGAAGAAGAATTCTCCTGG - Intergenic
1145925358 17:28642885-28642907 CAGTAGAAGCAGATTTCTTTTGG - Exonic
1156591452 18:38494137-38494159 GAAAGGAAGCAGATTTCTCATGG + Intergenic
1156786442 18:40921161-40921183 CAATGAAAGCTGGTTTCTCCTGG - Intergenic
1158018540 18:52813169-52813191 AAATTTAAGAAGATTTTTCCTGG - Intronic
1166812127 19:45521040-45521062 CACTTGCCCCAGATTTCTCCAGG - Intronic
930050860 2:47215340-47215362 AAATTGAAAGAGCTTTCTCCAGG + Intergenic
930428114 2:51237129-51237151 CAATAGAAACAGATTTCTTGTGG - Intergenic
931570360 2:63662683-63662705 GAATTTAAGCAAATGTCTCCTGG + Intronic
932720602 2:74136518-74136540 CAATGGAAGAAGAATTCTCTTGG - Intronic
932844488 2:75121303-75121325 GAATTGATGAAGATTTCTCCAGG - Intronic
934160379 2:89243884-89243906 TAATTGAAGCTGACCTCTCCTGG + Intergenic
934206896 2:89938554-89938576 TAATTGAAGCTGACCTCTCCTGG - Intergenic
936837069 2:116721966-116721988 AAATTGATGCAGAATTCTGCAGG + Intergenic
941343418 2:164336748-164336770 GAATGGAAACAGATTTCTCATGG - Intergenic
942260791 2:174160838-174160860 AAATTAAAGCAAATTACTCCGGG + Intronic
942698956 2:178681481-178681503 AAATTGAAACAGGTTTCTCAAGG + Intronic
944958981 2:204847289-204847311 CAATTTAAGCATATTTCTTATGG - Intronic
946009440 2:216553132-216553154 CACTTGTCGCAGTTTTCTCCTGG + Intronic
1171128878 20:22629714-22629736 AAATTAAAGCCCATTTCTCCTGG - Intergenic
1173198947 20:40939543-40939565 CAAGTGAAGGAGATTACTGCAGG - Intergenic
1173400580 20:42722460-42722482 CAGTAGAAGCAGATGTCTCATGG - Intronic
1177759224 21:25383884-25383906 CAGTGGAAGGAGATTACTCCAGG + Intergenic
1182807818 22:33090401-33090423 TAATTTAAACAGAATTCTCCAGG + Intergenic
1185396829 22:50596240-50596262 TAATTGAAGCACATTTCTTATGG + Intronic
951118246 3:18891205-18891227 GAATTCAACCAGATTTATCCAGG + Intergenic
951895289 3:27604089-27604111 CCATTGAAGCAGCTTACTCTTGG - Intergenic
956707314 3:72010565-72010587 CAGTTGGAGCAGATTCATCCTGG - Intergenic
960156229 3:114299535-114299557 GAAGTGAAGCTGATTTCCCCAGG - Intronic
961943826 3:130664847-130664869 AAATGAAAGCAGATTTCTCAGGG - Intronic
963914645 3:150847087-150847109 CTATTGTTGGAGATTTCTCCAGG + Intergenic
965597609 3:170423672-170423694 CAATTGAATCAGAATTTTCTGGG + Intronic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
970126694 4:12821566-12821588 CCATTGCTGGAGATTTCTCCAGG - Intergenic
972585168 4:40431104-40431126 CAATTGAAAAAGAATTATCCAGG - Intronic
974455468 4:62124600-62124622 CATTTCAAGCAGATTTCCCTGGG + Intergenic
978567565 4:110100234-110100256 CATTTGAGGAAGATTTCTCTGGG - Intronic
978676077 4:111317784-111317806 CAATTGAATCAAATTTCTTGGGG - Intergenic
979013471 4:115400740-115400762 AAAGTGCAGGAGATTTCTCCAGG + Intergenic
979740917 4:124149756-124149778 CAATTGAACCAGATTTGGCAAGG + Intergenic
980252082 4:130330459-130330481 GAATGGAAGCAGATCTCTCTGGG + Intergenic
980474235 4:133291034-133291056 CACTTGAACCAGATTTCTGGGGG - Intergenic
980816327 4:137951212-137951234 CACTTGAAGCAGAAGTTTCCAGG - Intergenic
988442066 5:31244584-31244606 CCAGTGAAGCAGAATGCTCCTGG - Intronic
988617375 5:32788066-32788088 CAACAGAAGCGGACTTCTCCAGG - Exonic
989265213 5:39465153-39465175 TAAGTGAAGCAGATTTCTGAAGG - Intergenic
989800965 5:45538862-45538884 CAATTGGAGCAAATCACTCCAGG - Intronic
990158316 5:52905303-52905325 TAATTGAAGATGATTTCTCTTGG - Intronic
990564726 5:57017704-57017726 CCATCGTAGCAGATATCTCCTGG - Intergenic
991024240 5:62012738-62012760 AAATTGAAGGAGTTTTCTCTGGG - Intergenic
993364528 5:87019786-87019808 CAATTAAAGCAGATTGTCCCTGG - Intergenic
995423560 5:111993483-111993505 TAATTGAAGCAGGGTTCTCCAGG - Intronic
995452036 5:112312938-112312960 CAATTAAAGTATATTTGTCCAGG + Intronic
996725249 5:126668642-126668664 CCATCGTAGCAGATATCTCCTGG - Intergenic
997924648 5:138018301-138018323 CACTTGATGCAGCTTTCTCAAGG - Exonic
999864013 5:155680581-155680603 CAATTGCAGTAGATTTATCCAGG + Intergenic
1001204487 5:169749590-169749612 CAGTTGAAACAGCTTCCTCCAGG + Intronic
1001967186 5:175918898-175918920 CAGCTGAAGCAGACATCTCCAGG - Intronic
1001967702 5:175923491-175923513 CAGCTGAAGCAGACATCTCCAGG - Intronic
1002249748 5:177920314-177920336 CAGCTGAAGCAGACGTCTCCAGG + Intergenic
1005318661 6:24629796-24629818 CAATAAAAGCACATTTCTCCTGG - Intronic
1008470751 6:51881618-51881640 CAATTGAAGAATATTTGACCAGG + Intronic
1008803675 6:55401839-55401861 CTAATGAATCAGAGTTCTCCAGG - Exonic
1009804262 6:68582046-68582068 GAATTCAAACAGATTTCTGCAGG + Intergenic
1010498176 6:76561634-76561656 GAATGGAAGCAGATGGCTCCAGG + Intergenic
1011345089 6:86360673-86360695 CAATTGTAGCAGATTTGGCTAGG + Intergenic
1012359438 6:98359094-98359116 CAGCTGAAGGACATTTCTCCAGG - Intergenic
1012677833 6:102139030-102139052 CATGTGAAGCAGATCCCTCCTGG - Intergenic
1018042183 6:159934525-159934547 AAATTGATGCCGATTTCACCAGG - Intergenic
1021371076 7:19848183-19848205 CTAATAAAGCAGATTTCTGCTGG - Intergenic
1028390312 7:90308965-90308987 AAATTGAACCTGATTTCTTCAGG + Intronic
1028954937 7:96677917-96677939 CAAGTTAAGTAGATTGCTCCTGG - Intronic
1030695865 7:112584545-112584567 AAATGGAAGCAGATGGCTCCGGG - Intergenic
1031734944 7:125347370-125347392 TAATTGAATCAGTTTTCTCATGG + Intergenic
1039685324 8:39795550-39795572 AAATTGAAGCAGGTTCTTCCAGG - Intronic
1040384584 8:46905681-46905703 CATTTGAAGCAGATTTCAGTTGG - Intergenic
1041128071 8:54665944-54665966 CACTTCCAGCAGCTTTCTCCTGG - Intergenic
1042798146 8:72686971-72686993 CCTGTGAATCAGATTTCTCCAGG - Intronic
1048477678 8:134757749-134757771 GAATTGTAGCAGATATGTCCTGG + Intergenic
1051203430 9:14657865-14657887 TATTTGAAACAGATTACTCCAGG + Intronic
1051650279 9:19316663-19316685 CAATTGAAGCAGATTTCTCCTGG + Exonic
1054993915 9:71362529-71362551 CAATTAAAGCATATTGCACCAGG + Intronic
1059127544 9:111706692-111706714 ATATTGGAGCAGATTTCCCCTGG - Exonic
1060558569 9:124523479-124523501 CAATTAAACCAGAATTCTCCAGG + Intronic
1060708126 9:125826095-125826117 CAATTTTAGCTGTTTTCTCCTGG - Intronic
1185452827 X:291837-291859 CAAGGGAAGCAGATCTCACCAGG - Intronic
1187497111 X:19804675-19804697 CTATTGAATCAGATCTCTGCAGG - Intronic
1187854706 X:23625584-23625606 AAATTGAAACAGTTTTCCCCTGG - Intergenic
1191873093 X:65766591-65766613 TAATTGAAGCTGATTCCTCATGG + Intergenic
1192281650 X:69693755-69693777 CTATTGCTGGAGATTTCTCCAGG + Intronic
1196119232 X:112030642-112030664 GGATAGAAGCAGATTCCTCCAGG - Intronic
1196178443 X:112665489-112665511 CAGTTGAAACAGACTTCTTCAGG - Intronic
1197247126 X:124177740-124177762 CAATTAAAGCATATTGCTGCTGG + Intronic
1199557219 X:149122576-149122598 TAGTGGAAGCAGATTTATCCAGG + Intergenic
1199893645 X:152112561-152112583 GAATTAAAGCACATTTCCCCTGG - Intergenic
1201891256 Y:18946243-18946265 TCATTGCAGCAGATATCTCCTGG - Intergenic