ID: 1051663275

View in Genome Browser
Species Human (GRCh38)
Location 9:19445104-19445126
Sequence GACCCAGGAGTGGTCCCCTC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051663272_1051663275 -5 Left 1051663272 9:19445086-19445108 CCATAGGAGATCTTGACTGACCC 0: 1
1: 0
2: 0
3: 6
4: 84
Right 1051663275 9:19445104-19445126 GACCCAGGAGTGGTCCCCTCCGG No data
1051663271_1051663275 -4 Left 1051663271 9:19445085-19445107 CCCATAGGAGATCTTGACTGACC 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1051663275 9:19445104-19445126 GACCCAGGAGTGGTCCCCTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051663275 Original CRISPR GACCCAGGAGTGGTCCCCTC CGG Intronic
No off target data available for this crispr