ID: 1051664416

View in Genome Browser
Species Human (GRCh38)
Location 9:19455347-19455369
Sequence CTTTGGGAGGGGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051664404_1051664416 11 Left 1051664404 9:19455313-19455335 CCTGGTGCGGTGGCTCGTGCCTG 0: 78
1: 5340
2: 36869
3: 114218
4: 188450
Right 1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG No data
1051664407_1051664416 -8 Left 1051664407 9:19455332-19455354 CCTGTAATCCCAGCACTTTGGGA 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
Right 1051664416 9:19455347-19455369 CTTTGGGAGGGGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051664416 Original CRISPR CTTTGGGAGGGGAAGGTGGG TGG Intergenic
No off target data available for this crispr