ID: 1051665170

View in Genome Browser
Species Human (GRCh38)
Location 9:19462145-19462167
Sequence TATAGACAACTGAGGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051665170_1051665178 18 Left 1051665170 9:19462145-19462167 CCCACCTCCCTCAGTTGTCTATA No data
Right 1051665178 9:19462186-19462208 AGGGTCTTGCTCTGTCACTCAGG 0: 418
1: 5959
2: 25107
3: 70272
4: 129163
1051665170_1051665179 22 Left 1051665170 9:19462145-19462167 CCCACCTCCCTCAGTTGTCTATA No data
Right 1051665179 9:19462190-19462212 TCTTGCTCTGTCACTCAGGCTGG 0: 1477
1: 30693
2: 79857
3: 153802
4: 162107
1051665170_1051665175 -2 Left 1051665170 9:19462145-19462167 CCCACCTCCCTCAGTTGTCTATA No data
Right 1051665175 9:19462166-19462188 TATCCAATCTATTTTGAGACAGG No data
1051665170_1051665176 -1 Left 1051665170 9:19462145-19462167 CCCACCTCCCTCAGTTGTCTATA No data
Right 1051665176 9:19462167-19462189 ATCCAATCTATTTTGAGACAGGG No data
1051665170_1051665180 23 Left 1051665170 9:19462145-19462167 CCCACCTCCCTCAGTTGTCTATA No data
Right 1051665180 9:19462191-19462213 CTTGCTCTGTCACTCAGGCTGGG 0: 36
1: 679
2: 1759
3: 3293
4: 4094

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051665170 Original CRISPR TATAGACAACTGAGGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr