ID: 1051667169

View in Genome Browser
Species Human (GRCh38)
Location 9:19476328-19476350
Sequence GGCTGTCTCCCATTTTCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051667160_1051667169 14 Left 1051667160 9:19476291-19476313 CCGTGGCCACATGGCTGCCACAC No data
Right 1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG No data
1051667156_1051667169 24 Left 1051667156 9:19476281-19476303 CCTCTGCTCCCCGTGGCCACATG No data
Right 1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG No data
1051667159_1051667169 15 Left 1051667159 9:19476290-19476312 CCCGTGGCCACATGGCTGCCACA No data
Right 1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG No data
1051667158_1051667169 16 Left 1051667158 9:19476289-19476311 CCCCGTGGCCACATGGCTGCCAC No data
Right 1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG No data
1051667165_1051667169 -3 Left 1051667165 9:19476308-19476330 CCACACAGGGCTCAAGTAGAGGC No data
Right 1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG No data
1051667163_1051667169 8 Left 1051667163 9:19476297-19476319 CCACATGGCTGCCACACAGGGCT No data
Right 1051667169 9:19476328-19476350 GGCTGTCTCCCATTTTCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051667169 Original CRISPR GGCTGTCTCCCATTTTCAGG GGG Intergenic
No off target data available for this crispr