ID: 1051671517

View in Genome Browser
Species Human (GRCh38)
Location 9:19515351-19515373
Sequence CAGGGTACTCTGGTGGAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 234}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051671511_1051671517 -7 Left 1051671511 9:19515335-19515357 CCCTGAGTTTCTTGGTCAGGGTA 0: 1
1: 0
2: 2
3: 13
4: 130
Right 1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234
1051671506_1051671517 12 Left 1051671506 9:19515316-19515338 CCTCTTTCTGTCCTAAGTACCCT 0: 1
1: 0
2: 1
3: 18
4: 225
Right 1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234
1051671512_1051671517 -8 Left 1051671512 9:19515336-19515358 CCTGAGTTTCTTGGTCAGGGTAC 0: 1
1: 0
2: 0
3: 12
4: 94
Right 1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234
1051671507_1051671517 1 Left 1051671507 9:19515327-19515349 CCTAAGTACCCTGAGTTTCTTGG 0: 1
1: 0
2: 1
3: 20
4: 211
Right 1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234
1051671505_1051671517 24 Left 1051671505 9:19515304-19515326 CCTGGGTTTTTACCTCTTTCTGT 0: 1
1: 0
2: 2
3: 32
4: 375
Right 1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234
1051671503_1051671517 29 Left 1051671503 9:19515299-19515321 CCCAGCCTGGGTTTTTACCTCTT 0: 1
1: 0
2: 3
3: 28
4: 346
Right 1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234
1051671504_1051671517 28 Left 1051671504 9:19515300-19515322 CCAGCCTGGGTTTTTACCTCTTT 0: 1
1: 0
2: 1
3: 32
4: 340
Right 1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG 0: 1
1: 0
2: 0
3: 18
4: 234

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051671517 Original CRISPR CAGGGTACTCTGGTGGAGGT GGG Exonic
901772562 1:11537721-11537743 CAGGGCACCCTAGGGGAGGTGGG + Intergenic
903420359 1:23214635-23214657 CAGGGTGATGTGGTGGAGGAGGG - Intergenic
903753220 1:25643003-25643025 CAGGGTTCTGTGGGGGACGTAGG + Intronic
903827515 1:26156543-26156565 CAGGGATCTCTGGTGGGGGCTGG - Intergenic
904031701 1:27537140-27537162 CAGGGTTCTCTCATGGAGGTGGG + Intronic
904384348 1:30131747-30131769 CAGGCTACTCTGATGGAATTTGG + Intergenic
904923317 1:34025927-34025949 CAGGGTACTGGGGTGGGGCTGGG + Intronic
905179001 1:36155442-36155464 CGGGGTCGTCTGGTGGGGGTGGG + Intronic
906105416 1:43288964-43288986 CCAGGAAGTCTGGTGGAGGTGGG + Intergenic
906781520 1:48576826-48576848 AAGGGTAGTGTGGTGGATGTGGG + Intronic
907047554 1:51308966-51308988 CAGGGTGTTCTGGTGGGGGCAGG - Intronic
913666612 1:121054630-121054652 CTAGGTTCTCTGGTGGATGTGGG - Intergenic
914018295 1:143841754-143841776 CTAGGTTCTCTGGTGGATGTGGG - Intergenic
914656910 1:149750271-149750293 CTAGGTTCTCTGGTGGATGTGGG - Intergenic
916001684 1:160622650-160622672 CATGGTATTGTGGTGGAGATTGG - Intronic
916983801 1:170168313-170168335 TAGAGTATTCTGGTGGGGGTGGG + Intergenic
917703112 1:177601138-177601160 CAGAGGACACTGGTGGAGCTTGG - Intergenic
918315185 1:183317242-183317264 CAGGGTATGCTGGAGGATGTGGG - Intronic
918950236 1:191126591-191126613 CAGTGTTCTGTGGTGGTGGTTGG - Intergenic
920002314 1:202808206-202808228 CCGGGCACTCGGGTGGAGGCAGG + Exonic
924709066 1:246519346-246519368 CAGAGGACCCTGGGGGAGGTGGG - Intergenic
1062929149 10:1340987-1341009 CAGGGTTCTCTGGTGGATGCTGG - Intronic
1062929176 10:1341155-1341177 CATGGTTCTCTGGTGGATGCTGG - Intronic
1063931167 10:11029614-11029636 CAGGGAACTTTGCTGGAGGCAGG + Intronic
1064724481 10:18264524-18264546 GTGGGTACCCTGGGGGAGGTGGG - Intronic
1067229131 10:44394810-44394832 GAGGTTACTCAGGTGGTGGTGGG + Intergenic
1068521252 10:58080034-58080056 CAGGGCAGTCCGGTGGTGGTGGG - Intergenic
1070288437 10:75099946-75099968 CAGTGTAGTGTGGTGGAGTTGGG + Intronic
1072449716 10:95530275-95530297 CAGGGTCCTCTGGGAGAGGTAGG - Intronic
1073562239 10:104506752-104506774 AAGGCTGCTCTGGAGGAGGTCGG - Intergenic
1073582727 10:104682640-104682662 CAGGCTGCTCTGGAAGAGGTTGG + Intronic
1073936669 10:108640660-108640682 CAGGGGAGTTTGGTGGGGGTAGG + Intergenic
1074436101 10:113435776-113435798 AAGGATTCTCTGGTGGATGTGGG + Intergenic
1074469934 10:113717723-113717745 CAGGTTACTTTTGTGGAGGGTGG - Intronic
1074517694 10:114186238-114186260 CAGGGGAATCAGGTGGTGGTTGG - Intronic
1074578872 10:114697072-114697094 CAGGGCACTCTGGGGGAGGAAGG + Intergenic
1075798385 10:125136552-125136574 CAAGGTACTGTGGAGGATGTGGG + Intronic
1077146825 11:1050196-1050218 CAGGGGACCCTGGTGCAGGAGGG + Intergenic
1077335161 11:2000196-2000218 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1077335339 11:2001009-2001031 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1077383306 11:2257452-2257474 CGGGGTACCCTGGAGGAGGCAGG - Intergenic
1077894035 11:6440532-6440554 CAGCGTTCTGGGGTGGAGGTAGG + Exonic
1078653379 11:13216322-13216344 CAGCCTCCTCTGGTGGGGGTGGG + Intergenic
1080049714 11:27847124-27847146 CAGGGAGCTCTGCTGGGGGTTGG + Intergenic
1081058160 11:38437042-38437064 CATGTTATTCAGGTGGAGGTCGG - Intergenic
1081834478 11:46142889-46142911 CAGGGGCCTGTGGTGGGGGTGGG - Intergenic
1083170821 11:60923193-60923215 CAGGGTACCCTGGTGGAGAGGGG - Exonic
1083310141 11:61779764-61779786 CAGTGGGCTCTGCTGGAGGTCGG - Intronic
1084267581 11:68012782-68012804 CAGGGGACTGTGAGGGAGGTGGG + Intronic
1084389194 11:68864091-68864113 CAGGCTTCTCTGGTGGAGGCAGG + Intergenic
1085303731 11:75473548-75473570 GAGGGCCCTCAGGTGGAGGTGGG - Intronic
1087370194 11:97274120-97274142 CAGGTAACTCTGGTGGCAGTAGG - Intergenic
1088183222 11:107135542-107135564 GAGGGCACTCTGGTTGAGATTGG + Intergenic
1088359121 11:108972916-108972938 CTAGGAGCTCTGGTGGAGGTGGG + Intergenic
1088825964 11:113494964-113494986 CAGAGGTCTGTGGTGGAGGTGGG - Intergenic
1089605225 11:119637854-119637876 CAGGGTACAGAGCTGGAGGTGGG + Intronic
1090858473 11:130632120-130632142 GAGGATACACTGGTGGGGGTTGG - Intergenic
1090944085 11:131414146-131414168 CAGGGTATTCTGGTGAAAGGTGG + Intronic
1202818144 11_KI270721v1_random:55378-55400 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1202818322 11_KI270721v1_random:56191-56213 CAGGGTGCACTGTTGAAGGTTGG - Intergenic
1092443524 12:8531130-8531152 CAGGGCATCCTGGTGGGGGTTGG - Intergenic
1094818919 12:34210092-34210114 CAGGGCACTGTGGTGTGGGTGGG + Intergenic
1095226336 12:39681306-39681328 CTGGGGACTCTGGTGGAGGGTGG + Intronic
1097066382 12:56323690-56323712 CAGGGATCTCTGGTGGAGTGAGG - Intronic
1098529382 12:71523341-71523363 CTGGGTACTATGATGGAGATGGG - Intronic
1101771286 12:107753960-107753982 GAGGGTAAGGTGGTGGAGGTAGG + Exonic
1102804487 12:115767680-115767702 TGGTGTACTCTGGTGGGGGTGGG + Intergenic
1102969962 12:117158392-117158414 TAGGGCACTCTGGATGAGGTGGG + Intronic
1104071535 12:125350084-125350106 CAGTGTCCTCTGGAGGAGGAAGG + Exonic
1105539430 13:21302631-21302653 CAGGGTGGTATGGGGGAGGTGGG - Intergenic
1106393020 13:29354067-29354089 CAGGGGACTCAGGTGGAGCCTGG - Intronic
1110415799 13:75250923-75250945 CTGGGAACTGTGGTGGAGGATGG - Intergenic
1114450956 14:22825101-22825123 CATGGAACTCTGTTGGAGGGAGG - Intronic
1114645974 14:24256327-24256349 CAGGCTGCTCTGCTGGAGGATGG + Intronic
1115742551 14:36403751-36403773 GAGGTTACTGTGGTGGAGGGTGG - Intergenic
1115781622 14:36775831-36775853 CAGGGTATTTGGGTGGGGGTAGG - Intronic
1118351411 14:64974685-64974707 CTCGGTACTCTGGTGGTCGTGGG - Intronic
1118381674 14:65222623-65222645 CAGGGGCCTCTGGGGGAGGATGG + Intergenic
1118760099 14:68875693-68875715 CAGGGCACTCTGGCAGAGGTAGG - Intronic
1118845438 14:69544549-69544571 CAAGGTTCTCTGGTGGAAGCAGG - Intergenic
1121864843 14:97353209-97353231 CAGGGGACTCCGGTGGAAGGAGG - Intergenic
1122203964 14:100139076-100139098 CAGGGTGCCATGGTGGAGGCTGG + Intronic
1122937660 14:104967420-104967442 CAGGGTAGTCTTGTGGGTGTTGG + Intronic
1123006028 14:105324319-105324341 CAGGGTGCTCAGGTGCAGGTGGG + Intronic
1123052213 14:105550148-105550170 CACGTTACTCTGGTGGGGGTTGG + Intergenic
1125601941 15:40920163-40920185 CAGGGTAGTCTGGAGCAGGGAGG - Intergenic
1129667091 15:77585273-77585295 CAGGGTGGTGGGGTGGAGGTGGG + Intergenic
1132185447 15:99798792-99798814 GAGGGGACCCTGGGGGAGGTAGG + Intergenic
1132410834 15:101577211-101577233 GATGCTGCTCTGGTGGAGGTTGG - Intergenic
1134827901 16:17299227-17299249 CTGGATGCTCTGGTGGTGGTGGG - Intronic
1135156533 16:20057669-20057691 CAGGGTCCTCTGGTGGGCCTTGG - Intronic
1135590725 16:23703296-23703318 CAGGGAACACTAGAGGAGGTGGG - Intronic
1137328090 16:47461445-47461467 CAAGGTACTCGGGTGGGGGGCGG - Intronic
1141987522 16:87589494-87589516 CAGGGGACTCTGATGCATGTGGG + Intergenic
1142265482 16:89062348-89062370 CAGGGTCTCCTGGTGGTGGTGGG + Intergenic
1142402969 16:89870674-89870696 CAGGGCACTCTGGTCCAGCTGGG - Exonic
1143217262 17:5234323-5234345 CATGGTGCTATGCTGGAGGTGGG - Intronic
1143620102 17:8075780-8075802 CAGGGCACCCTGGGGGAGGTGGG - Intronic
1143670340 17:8392284-8392306 TGGGGTGCTGTGGTGGAGGTCGG + Exonic
1144574060 17:16417909-16417931 CCGGGTGCTCTGCTGGAGCTGGG - Intronic
1145775037 17:27521738-27521760 AAGGCTACTCTGATGGAGGCAGG + Intronic
1145883675 17:28368853-28368875 AAGGGTACTCAGGGGGTGGTGGG - Exonic
1146603169 17:34235824-34235846 CCGGGTACTCCAGTGGAGCTTGG + Intergenic
1148843070 17:50511578-50511600 CAAGGTGCTCAGGTGGGGGTAGG - Intronic
1151326378 17:73382287-73382309 CTGGGTACTCAGGTGGGTGTGGG - Intronic
1151699952 17:75737706-75737728 CTGGGGACCCTGGTGGAGGGTGG - Intronic
1151700042 17:75737934-75737956 CTGGGGACCCTGGTGGGGGTTGG - Intronic
1151866050 17:76803712-76803734 CAGGATAATTTGGTGGGGGTGGG - Intergenic
1157438750 18:47693512-47693534 CAGTGTACTTTGGAAGAGGTGGG + Intergenic
1158066286 18:53413163-53413185 CAGAGGATTCTGGTGGAGGGAGG + Intronic
1159028293 18:63206752-63206774 AAGGGGACTCTGGTGTGGGTGGG + Intronic
1159087251 18:63807811-63807833 CAGGAGCCCCTGGTGGAGGTGGG - Intergenic
1159369629 18:67514275-67514297 CAGCATGCTTTGGTGGAGGTAGG + Exonic
1160018857 18:75165067-75165089 CAGGGTACCCTGTAGGAGCTGGG + Intergenic
1161021502 19:2013628-2013650 CAGGGGTCTCTGGCTGAGGTGGG + Intronic
1163250309 19:16122851-16122873 CACAGTTCTCTGGTGGAGGGTGG + Intronic
1166209564 19:41297492-41297514 TGGGGTCCTCTGTTGGAGGTGGG + Intronic
1166316973 19:41994548-41994570 AAGGGTACGCTGGGGGAGGGGGG + Intronic
1166656278 19:44614278-44614300 CAGGGCATTCTGGTGGAAGGGGG - Intronic
1166700538 19:44879282-44879304 CTGGGCCCTCGGGTGGAGGTGGG + Intronic
1166925469 19:46264071-46264093 CAGGGCAATCTAGTGGAGTTAGG - Intergenic
1167669774 19:50844079-50844101 CAGGTTTCTCAGGTGGAGGATGG + Intergenic
1168721067 19:58555304-58555326 CTGGGTCCTCAAGTGGAGGTTGG - Intergenic
926537327 2:14129233-14129255 CTGGGTTCTGTGGTGGATGTTGG + Intergenic
926792247 2:16585757-16585779 CAGAGTACTCTGGTAGTAGTGGG + Intronic
927714440 2:25342567-25342589 CAGTGGGCTCTGGCGGAGGTCGG - Exonic
928735865 2:34288345-34288367 CAGCATACCATGGTGGAGGTAGG + Intergenic
929747552 2:44674582-44674604 TAGGGCACTTTGGTTGAGGTTGG - Intronic
929776084 2:44931828-44931850 CAGGGTATTGGGGTGGAGTTGGG + Intergenic
929881767 2:45843046-45843068 CAGGGTCGTCGGGTGAAGGTAGG + Exonic
931517276 2:63057371-63057393 CAGGGTACAGAGGTGGGGGTTGG + Exonic
932587509 2:73040834-73040856 CAGGTAACTCTGTGGGAGGTGGG - Exonic
933723439 2:85412540-85412562 TAGGGTAGTTTGGTGGAGGGTGG + Intronic
935019097 2:99213396-99213418 GAGTGTGCTCTGGTGGGGGTGGG - Intronic
936835428 2:116703810-116703832 CAGGGTCCTGTGATGGAAGTTGG - Intergenic
938029960 2:127983586-127983608 AAGGGCACTGGGGTGGAGGTTGG + Intronic
938518088 2:132037538-132037560 CAGGGTCCCTTGGGGGAGGTGGG - Intergenic
940316271 2:152330799-152330821 CAGGGTAATCCAGTGGTGGTGGG - Intergenic
941562029 2:167058618-167058640 CAGGCTATTCTGCTGGAGGGAGG - Intronic
942561053 2:177219034-177219056 CAGGTAACTATGGTGGTGGTGGG + Exonic
943113849 2:183642009-183642031 TAGGATACTCTTGTGGAGGTAGG - Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
946287968 2:218719736-218719758 CAGGTTATTCTGATGCAGGTGGG + Intronic
946366567 2:219252745-219252767 CAGGGTGCGGGGGTGGAGGTGGG - Intronic
946406219 2:219493305-219493327 GAGAGGACTCAGGTGGAGGTGGG + Exonic
947526042 2:230877300-230877322 CAGGGGCCTCTGGAGGAGGGAGG + Intronic
948691283 2:239706691-239706713 GAGGGCACTCTGGAGGAGGAAGG + Intergenic
1174064103 20:47852264-47852286 CAGGGTGGGATGGTGGAGGTGGG + Intergenic
1174939308 20:54906958-54906980 CCGGGGACTGTGGTGGAGTTGGG + Intergenic
1175574278 20:60048995-60049017 CTGGGTAGTGTGGTGGAGGTGGG + Intergenic
1175970487 20:62684439-62684461 CAGCGTAGCCTGGTGGGGGTTGG - Intronic
1176000923 20:62830788-62830810 CAGGGGACTGTGGTGGGGGGTGG - Intronic
1177017264 21:15807583-15807605 CACCGTACTCTGGTGGCTGTTGG + Intronic
1178668481 21:34569545-34569567 CAGGGTAGGCAGGTGGAGGAAGG - Intronic
1178949417 21:36974133-36974155 CAGGGTCCCCTGGTGGAAGCTGG + Intronic
1181175030 22:21030398-21030420 CAGGGGCCTCTGCTGGGGGTCGG + Intronic
1181342687 22:22195497-22195519 CAGCGCCCTCTGGTGGATGTGGG - Intergenic
1181675056 22:24445885-24445907 CAGGGTCCTCTGAGGGAGGTGGG + Intergenic
950069489 3:10141059-10141081 CAGAGCACTCTGGTGGAAATTGG - Exonic
951186357 3:19718163-19718185 TAAGGTACTCTGCTGGATGTTGG - Intergenic
953232751 3:41079168-41079190 CTGGGTACTCTGGCAGAGTTTGG - Intergenic
955813630 3:62819011-62819033 CAGGGGATGGTGGTGGAGGTGGG + Intronic
958822079 3:98987223-98987245 CAGGGCTCTGTGGTGGGGGTGGG + Intergenic
959330365 3:104997003-104997025 GAGGGTAGGGTGGTGGAGGTCGG - Intergenic
961784859 3:129341572-129341594 CAGGGCCATGTGGTGGAGGTGGG - Intergenic
965196710 3:165606991-165607013 AAGGGTACTGTGGTTGAGTTTGG - Intergenic
968555877 4:1246247-1246269 CAGGGTCCTCTGGTGGTCGCTGG - Intronic
968581376 4:1396941-1396963 CAGGGCAGTCGGGAGGAGGTGGG + Intergenic
968628664 4:1639070-1639092 CAGGGCCCTCTGCTGCAGGTCGG - Intronic
969279540 4:6160873-6160895 CAGGGTAGGCGAGTGGAGGTCGG - Intronic
969439300 4:7208027-7208049 CAAGGGACACTGGGGGAGGTGGG - Intronic
972642076 4:40934067-40934089 GAGGCTGCTCTGGTGGCGGTAGG + Intronic
974470879 4:62316272-62316294 CAGGGAATTGTGGGGGAGGTGGG - Intergenic
975264230 4:72343032-72343054 CAGTGTACTCTGCTGGGGGCTGG - Intronic
978485330 4:109247190-109247212 CAGGCTAATTTGGTGGAGATGGG - Intronic
979528091 4:121738476-121738498 CAGTGGACTCTTGTGGAGGCTGG + Intergenic
981290918 4:143073611-143073633 AAGGGAACTCTGCTAGAGGTTGG - Intergenic
982592148 4:157326919-157326941 CAGGGAGCGCTGGTGGAGGCAGG + Intronic
985671100 5:1207057-1207079 CAGGGTGCTCGGGTTCAGGTAGG + Intronic
985679118 5:1246771-1246793 CGGGGTACTCTGGAGCAGGGCGG - Intergenic
986452724 5:7882189-7882211 CAGGGTTCTCTGGAGCTGGTGGG + Intronic
988503100 5:31799576-31799598 CAGGGTCCTGTGCTGGATGTGGG + Exonic
992477561 5:77118444-77118466 CAGAGTACTCTGGGTGAGGAGGG + Intergenic
994264036 5:97693306-97693328 CTGGGAACTCTGGGGAAGGTGGG - Intergenic
994963260 5:106632543-106632565 CACGTTACTCTAGTTGAGGTAGG + Intergenic
994972119 5:106754199-106754221 GAGGGTACTCTGATAGAAGTGGG + Intergenic
997640697 5:135446961-135446983 CAAAGTTCTCTGGTGGAGCTGGG + Exonic
997836702 5:137200179-137200201 CAGGGACATCTGGTGGAGGGTGG - Intronic
999368130 5:151036101-151036123 CAGGGTGCCCTGGCAGAGGTGGG + Intronic
1001417419 5:171555708-171555730 GAGTGTCCCCTGGTGGAGGTCGG - Intergenic
1002591914 5:180296253-180296275 CTGGGAAATCTGGTGGGGGTGGG - Intergenic
1002895772 6:1379295-1379317 CAGGGTATTCTGGAGCAGGAGGG + Intergenic
1006058956 6:31405043-31405065 GAGGGTGCTCTGGGGGAGGGTGG - Intronic
1006071441 6:31499928-31499950 GAGGGTGCTCTGGGGGAGGGTGG - Intronic
1006146092 6:31960544-31960566 CAGGTGACTCTTGTGGAGATGGG + Exonic
1006188166 6:32192038-32192060 AAGGGGAGTCTGGAGGAGGTGGG + Intronic
1006978196 6:38123491-38123513 CAGGGTTTTCTGGTGGATCTAGG - Intronic
1007712749 6:43835035-43835057 CAGGGGACAATGGAGGAGGTAGG + Intergenic
1013313766 6:108922077-108922099 CAGAGTACTCTGATGGAGGAAGG + Intronic
1013622063 6:111899578-111899600 CAGGGCAGTCTGGTGGCAGTGGG + Intergenic
1015735736 6:136398166-136398188 CAGGGTACTGTGGTGGATAGAGG + Intronic
1016303144 6:142654254-142654276 CGGGGTTCTCTGGTGGATCTTGG - Intergenic
1016414724 6:143820559-143820581 CTGGGTACTCTGGTGTAAGTGGG + Intronic
1017530681 6:155289228-155289250 CAGGGTCCTCTGGAGATGGTGGG + Intronic
1017567133 6:155699542-155699564 CATGGAAATCTGGTGCAGGTTGG + Intergenic
1017723409 6:157260045-157260067 GAGGATAATCTGGTGGAGGAAGG - Intergenic
1019318918 7:406038-406060 CAGGGTGGTCTGGAGGAGGGAGG - Intergenic
1020804532 7:12772374-12772396 CAGGTTACTCTGAGGGAAGTGGG + Intergenic
1025640704 7:63365382-63365404 CAGGGTCCTCTGTTGTAGGGAGG + Intergenic
1025641995 7:63382704-63382726 CAGGGTCCTCTGTTGTAGGGAGG - Intergenic
1025738501 7:64175343-64175365 CAGGGTCCTCTGTTGTAGGATGG + Intronic
1026447667 7:70499595-70499617 CAGGGTTCTCTGGCTGAGGTGGG - Intronic
1027746305 7:82079324-82079346 CAAAGTATACTGGTGGAGGTGGG + Intronic
1029052171 7:97700577-97700599 CTCAGTACTCTGGTGGAGGGTGG - Intergenic
1029207446 7:98878296-98878318 CCGGGTACCCTGGGGGCGGTGGG - Intronic
1032505026 7:132428142-132428164 CAGGGTTCTCTGGTGGGGGCAGG - Intronic
1033130784 7:138743917-138743939 CAGGGGACTCTGGAGGAGAGGGG - Intronic
1037088812 8:14886908-14886930 CAGAGTACTGCAGTGGAGGTGGG + Intronic
1037913175 8:22756517-22756539 CATGGGACAGTGGTGGAGGTTGG - Intronic
1040561301 8:48525431-48525453 CAGGGAGCTCTTGTGGAGGCTGG + Intergenic
1042452946 8:68970818-68970840 CAGGGTAGTCTGGTTCAGATAGG - Intergenic
1043534983 8:81192986-81193008 CTGGGGACTCGGGGGGAGGTTGG - Intergenic
1045045337 8:98269839-98269861 CTGGGAACTCTGGAGGAGGGAGG - Intronic
1045832759 8:106483820-106483842 CAAGGTTATCTGGGGGAGGTTGG - Intronic
1049002050 8:139832463-139832485 CAGGGGAGGCTGGTGGGGGTGGG + Intronic
1051671517 9:19515351-19515373 CAGGGTACTCTGGTGGAGGTGGG + Exonic
1052493331 9:29194030-29194052 CAGATTACTGTGGTGGAGGCTGG - Intergenic
1053066740 9:35074408-35074430 CACTGCACTCTGGTGGAGGCTGG - Exonic
1055664267 9:78537948-78537970 CAGATTCCTCTGGTTGAGGTGGG + Intergenic
1056192628 9:84199165-84199187 CAGGGCACACTGGTGGAAGGGGG + Intergenic
1059405940 9:114098453-114098475 CGGGGCACTCTGGAGGAGGGCGG + Intronic
1059405972 9:114098531-114098553 CGGGGCACTCTGGAGGAGGGCGG + Intronic
1059524552 9:114978523-114978545 TAGGGTACACCTGTGGAGGTAGG + Intergenic
1059655471 9:116353694-116353716 CATGGAATTTTGGTGGAGGTGGG - Exonic
1059905673 9:118983057-118983079 AAATGTCCTCTGGTGGAGGTTGG - Intergenic
1060114659 9:120930409-120930431 CAGGGTACTCTAGTGAAAGGGGG + Intergenic
1060843543 9:126815801-126815823 CAGGATACTGAGGTGGGGGTGGG - Intronic
1061507018 9:131037133-131037155 CAGGACTCTCTGGTGGAGGCAGG - Intronic
1187724732 X:22190608-22190630 CAGGGTATGCTGGTGAAGGAAGG + Intronic
1188040648 X:25366947-25366969 CAGTGAACTGAGGTGGAGGTCGG - Intergenic
1189353045 X:40291386-40291408 CAGGATAATGTGCTGGAGGTGGG - Intergenic
1190058804 X:47197886-47197908 CAGGGTACTCCTGTGGGGTTTGG - Intronic
1190212660 X:48460408-48460430 CAGGGTAGTCAGTTGGAGGGAGG - Intronic
1190730886 X:53224844-53224866 CCGGGCACTCCGGTGGCGGTAGG + Exonic
1192191961 X:68996377-68996399 CAGCCTTCTCTGCTGGAGGTGGG - Intergenic
1192410454 X:70928808-70928830 CAGGGTATAATGGTGGGGGTTGG - Intronic
1192763312 X:74118835-74118857 GAGGGTGCCCTGGTGGTGGTGGG - Intergenic
1192823105 X:74665353-74665375 CAGGGTTCTCTGGTAAAGCTAGG + Intergenic
1194580652 X:95666423-95666445 CTGGGTGCTCTGGATGAGGTGGG + Intergenic
1194815560 X:98437205-98437227 TAGGGAGCTCTGGGGGAGGTGGG - Intergenic
1195142170 X:101972704-101972726 CAGGGTCTTGTGGTGGAGGGTGG - Intergenic
1196997094 X:121396046-121396068 CATGTTCCTCTGGTGGAGGGAGG + Intergenic
1200777150 Y:7179716-7179738 AACGTTACTCTGGTGGAGGCTGG + Intergenic