ID: 1051671918

View in Genome Browser
Species Human (GRCh38)
Location 9:19519174-19519196
Sequence AATCTATGCCTGGCATAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051671918 Original CRISPR AATCTATGCCTGGCATAGAG AGG (reversed) Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
900909315 1:5583653-5583675 AATTGATGCCAGGCACAGAGTGG - Intergenic
902605961 1:17569562-17569584 AATCTCTGTCTGGCAGGGAGGGG - Intronic
902870485 1:19311265-19311287 AGTCAAAGCCTGGCATAGAGTGG + Intronic
903361901 1:22782270-22782292 ACACAATGCCTGGCATAGATTGG + Intronic
907948279 1:59155715-59155737 AGACTAGGCCTAGCATAGAGAGG + Intergenic
907965249 1:59322663-59322685 AACATATGCCTGGCATATATGGG - Intronic
908261780 1:62344719-62344741 AAGCTCTGCCTGGCACATAGTGG - Intergenic
908338196 1:63148784-63148806 AATGAATGCCTAGCATAGTGGGG - Intergenic
910692281 1:89977148-89977170 AATCTATACTAGGCAGAGAGTGG - Intergenic
913706520 1:121429742-121429764 AACCTATGCATGGCAAAGAATGG - Intergenic
916501472 1:165390969-165390991 AATTTAGGCCTGGCCTAGAAGGG - Intergenic
917612845 1:176706569-176706591 AATTCATGCCTGGCATACAAGGG - Intronic
922092461 1:222409974-222409996 CATCTCTGCCTGGGATAGAAAGG - Intergenic
922356875 1:224784732-224784754 AATCTATGTCTGGCATGATGTGG + Intergenic
924017863 1:239747267-239747289 GATCAATGCCTGGCAGATAGTGG - Intronic
1063879227 10:10513831-10513853 GATCTATACTTTGCATAGAGAGG - Intergenic
1067208712 10:44241208-44241230 GGTGTATGCCTGGCATAGAAGGG - Intergenic
1070699150 10:78586694-78586716 AATCCAGGCCTGGCTTAGTGGGG + Intergenic
1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG + Intergenic
1073767195 10:106695648-106695670 ACACCATGCCTGGCATAAAGTGG + Intronic
1077988257 11:7377189-7377211 GAACAGTGCCTGGCATAGAGTGG - Intronic
1079307034 11:19332491-19332513 AATATAAGCCTGGACTAGAGGGG - Intergenic
1079501239 11:21103560-21103582 AAACTATGCTTGGCATAAAGTGG + Intronic
1083580464 11:63821569-63821591 AAACTATGCTTGGCATGGAGAGG - Intronic
1084937335 11:72594132-72594154 ACTCCATGCCTGACATACAGTGG + Intronic
1086182666 11:83972811-83972833 ATCCTGTGCCTGGCACAGAGTGG - Intronic
1089926115 11:122259588-122259610 AATCTATTCCTGGGTTAGACAGG - Intergenic
1092884341 12:12912306-12912328 AATGAGTGCTTGGCATAGAGAGG + Intronic
1096242996 12:49969237-49969259 CATCCCTGGCTGGCATAGAGGGG - Intronic
1096504483 12:52084039-52084061 AGAGTATGCCTGGCACAGAGCGG - Intergenic
1100591287 12:96032460-96032482 AGTCTATGTCTGGCATGTAGAGG - Intronic
1101735322 12:107458891-107458913 TTCCCATGCCTGGCATAGAGGGG - Intronic
1102157821 12:110744463-110744485 GAACAATGCCTGGCACAGAGTGG - Intergenic
1102412878 12:112735598-112735620 AATCTGTGCCTGGCAGAGCCTGG + Intronic
1106413580 13:29527710-29527732 AGACAATGCCTGGCATAGAAAGG + Intronic
1107462984 13:40622720-40622742 GCTCTATGCCTGGCATAAAATGG + Intronic
1110940822 13:81345448-81345470 AATCCATGACTGGCATTGTGGGG - Intergenic
1111981701 13:95023478-95023500 AAGCTATGTCTGGGATAGACAGG + Intronic
1112601222 13:100857520-100857542 GATCTGTGCCGGGCATAAAGTGG - Intergenic
1112802430 13:103127171-103127193 AATCTCTGCTTGGCAAACAGAGG - Intergenic
1113947122 13:114050614-114050636 GCTCTCTGCCTGGCATTGAGAGG - Intronic
1114636501 14:24190056-24190078 ATTCTTTGCCTGGCACAAAGAGG + Intronic
1119485847 14:74985951-74985973 AAACTATTCCTGGGACAGAGGGG + Intergenic
1119770497 14:77217817-77217839 TTTCTATGCCTGGCTTAGAAAGG - Intronic
1120871695 14:89343358-89343380 AATCTTTGGCTGTCATAGTGAGG - Intronic
1126691580 15:51292905-51292927 ATTCTCTGCTTGGCATTGAGGGG + Intronic
1129156780 15:73723019-73723041 AATCTCTTCCCGGCACAGAGGGG + Intergenic
1129275284 15:74441414-74441436 GCTCAATGCCTGGCACAGAGAGG + Intergenic
1129960855 15:79682513-79682535 AATCTCTGTCTGGAATGGAGGGG + Intergenic
1131863117 15:96675807-96675829 AAACTGTGCCTGACACAGAGTGG - Intergenic
1133920342 16:10147133-10147155 ATACTATGCCTGGCATACACAGG - Intronic
1134634360 16:15780768-15780790 AATCTAGACCAGGCACAGAGTGG - Intronic
1135962133 16:27004189-27004211 AAACTATGCCTTACATATAGAGG + Intergenic
1136986354 16:35109077-35109099 AGTCTGTTCCTGTCATAGAGGGG - Intergenic
1139073951 16:63419930-63419952 AACCTATGCCAGGGAAAGAGAGG - Intergenic
1141969756 16:87473105-87473127 CATCTATGCCTGCAATGGAGAGG - Intronic
1144654837 17:17028845-17028867 ACACTATGCCTGGCATATGGTGG - Intergenic
1148226468 17:45901213-45901235 AGTTTATTCCTGGCATGGAGTGG - Intronic
1150700686 17:67444452-67444474 AATCTAGGCCTGGGACAGAGAGG + Intronic
1150703301 17:67466345-67466367 AATCAATGGCTGACATTGAGAGG - Intronic
1152303940 17:79510522-79510544 AATGGATGCCTGGGATGGAGGGG - Intronic
1156586676 18:38438678-38438700 GATCTATGCATGGAGTAGAGAGG - Intergenic
1160731929 19:645107-645129 CATCTTTGGCTGGCATGGAGTGG + Intergenic
1162833353 19:13300482-13300504 AATCTGTGCCTGGGATAGTGTGG + Intronic
1163778863 19:19234969-19234991 CATCAATGTCTGGCAGAGAGGGG - Exonic
1164767012 19:30780026-30780048 AAGTTATGCCTTGCAGAGAGTGG - Intergenic
1166289397 19:41852357-41852379 TGTCTATGCCTGGCACAGAGCGG - Intergenic
926485116 2:13444408-13444430 TATCTATGCCTGGCCTGTAGTGG + Intergenic
928727898 2:34196387-34196409 AATCTAGCCCAGGCATAGAAAGG + Intergenic
929254335 2:39793024-39793046 AAACAGTGCCTGTCATAGAGTGG - Intergenic
929356830 2:41035580-41035602 AAACTTTACCTGGGATAGAGAGG - Intergenic
933675925 2:85057414-85057436 ACCCTATGCCTGGCCTGGAGTGG + Exonic
937620449 2:123979347-123979369 AATCTATGTCTGTCATTGTGTGG - Intergenic
939398256 2:141660013-141660035 AATGTTTCCCTGGCAGAGAGGGG + Intronic
939857223 2:147373885-147373907 AATCCCTGTTTGGCATAGAGTGG + Intergenic
941381416 2:164797376-164797398 AAACTATGCCTGTCATATAATGG - Intronic
942614992 2:177782415-177782437 AATCTTTGGATGGCATAGGGTGG - Intronic
946581727 2:221135617-221135639 GAACAATGCCTGGCATATAGGGG + Intergenic
946704601 2:222445797-222445819 CATCTAAGCCTGGCATTGGGAGG - Intronic
1168985557 20:2045608-2045630 GATCTATGCCTGGAATGCAGTGG + Intergenic
1173159484 20:40641785-40641807 AGCCTGTGCCTGGCACAGAGTGG - Intergenic
1178425358 21:32474651-32474673 AAGCAGTGCCAGGCATAGAGTGG + Intronic
1181978191 22:26747405-26747427 GAACAATGCCTGGCATACAGTGG - Intergenic
1182140206 22:27948314-27948336 CATCTATGCATGGCATGGATTGG + Intergenic
1182981495 22:34675556-34675578 GATCCATGCCTGGCAAGGAGTGG + Intergenic
1183069088 22:35383829-35383851 AATCAGTACCTGGCATATAGTGG - Intronic
1184516128 22:44963926-44963948 AATCAAAGCCTGGCACACAGAGG + Intronic
949769024 3:7558280-7558302 ATTTAATACCTGGCATAGAGTGG + Intronic
953648840 3:44781121-44781143 GCTCAATGCCTGGCACAGAGTGG + Intronic
954237412 3:49267370-49267392 AATCTGGGACTGGCATGGAGAGG + Intergenic
956150581 3:66238085-66238107 AAACTATGCTTGGCATGGAGTGG - Intronic
956454961 3:69411434-69411456 AATTTAAACCTGGGATAGAGAGG + Intronic
963681810 3:148387942-148387964 AATCTTTGCCTGGCAAAGGTTGG + Intergenic
966786756 3:183629587-183629609 AAGCTTTGCCTGGCCTAGTGGGG + Intergenic
967433322 3:189415019-189415041 ACACTATGCCTGGTATATAGTGG - Intergenic
970006645 4:11417334-11417356 AACCAATGCCTGGCAGACAGTGG - Intronic
970390353 4:15603634-15603656 AATCAATGCCTGGCTTAAAAGGG - Intergenic
972606079 4:40615152-40615174 AAACCATGCATGGCATACAGTGG + Intronic
975571797 4:75825477-75825499 AATCAATGCTTGGTATATAGTGG + Intergenic
977186413 4:93943451-93943473 GAAATATGACTGGCATAGAGTGG - Intergenic
980345797 4:131616610-131616632 AATCTATATCTAGAATAGAGAGG - Intergenic
981856444 4:149299062-149299084 AATATATGACTGGCATTGACAGG + Intergenic
983708087 4:170682738-170682760 AAACAATGCCTGGCCTAGAGTGG + Intergenic
984127087 4:175824737-175824759 AATATGTGCCTAGCATACAGTGG - Intronic
984701395 4:182820807-182820829 TCTCCATGCCTGGCATAGAGGGG + Intergenic
990174762 5:53095145-53095167 AATGTGTGCTTGGAATAGAGAGG + Intergenic
990539141 5:56754957-56754979 AATCTATGCCAGGCAGCGTGGGG - Intergenic
990734953 5:58850082-58850104 AATCTCTGGCTGGCCTAGTGGGG + Intronic
992831623 5:80598801-80598823 AATATATTCCTGGCCTTGAGTGG - Intergenic
992891148 5:81205498-81205520 AGCACATGCCTGGCATAGAGCGG + Intronic
992923732 5:81557794-81557816 AATCTATGCCAGTTATAGATTGG + Intronic
993048407 5:82895592-82895614 ACTCAGTGCCTGGCATAGAGTGG - Intergenic
994446844 5:99886282-99886304 AATGAATGCCTGGCTTGGAGAGG + Intergenic
995001372 5:107134706-107134728 ATTTTATGCCTTGCATAGAAGGG + Intergenic
995854751 5:116579171-116579193 AAGCTATGCTAGACATAGAGAGG - Intergenic
1001301156 5:170534810-170534832 AATCTATGCCGGGCATGGTATGG - Intronic
1006390574 6:33755753-33755775 GATCTGTGCCTGGCCTGGAGAGG - Intergenic
1007154884 6:39732837-39732859 AATCTGTGGCTGGCGTACAGGGG - Intergenic
1011672694 6:89698771-89698793 CATTTATTCCTAGCATAGAGTGG - Intronic
1014639989 6:123897707-123897729 AAGCAATGTCTGGCATAGAGAGG + Intronic
1014690615 6:124559057-124559079 AATCTATACCTGGTATACACTGG - Intronic
1015471484 6:133611504-133611526 AAGCATTGCCTGGCATAGAGTGG + Intergenic
1017085087 6:150706321-150706343 AAACTATGCCAGGCATGGTGCGG + Intronic
1017160134 6:151357831-151357853 AATGTCTTCCTGCCATAGAGAGG - Exonic
1018131631 6:160737414-160737436 AATCTGTGCCTGTGATAGACTGG - Intronic
1018213452 6:161504324-161504346 AGGCTATGCCTGGCAGGGAGTGG - Intronic
1021585699 7:22205204-22205226 AATCCATCCCTGGTAAAGAGTGG - Intronic
1022798663 7:33753848-33753870 ACTATGTGCCTGGCATACAGGGG + Intergenic
1023606949 7:41939679-41939701 AATCTGTGCTTGTCAAAGAGTGG - Intergenic
1030112957 7:106042091-106042113 AATCTACTCCTGGCACACAGGGG - Intergenic
1032403807 7:131641621-131641643 AAACCATGCTTTGCATAGAGAGG + Intergenic
1036673596 8:10810558-10810580 GAATTATGCCTGGCATGGAGTGG - Intronic
1038184106 8:25257248-25257270 GCTCGATGCCTGGCATAGAGAGG - Intronic
1040969918 8:53124794-53124816 ATTTTATGCTTGGCATAGAAGGG + Intergenic
1041932084 8:63297897-63297919 AAGCTACTCCTGGGATAGAGTGG - Intergenic
1044408287 8:91855813-91855835 ACTCTATGCCTAGCACAAAGAGG - Intergenic
1045682331 8:104676139-104676161 AATATATGCCTGAAATAAAGTGG + Intronic
1045764703 8:105653345-105653367 ATTCTCTACCTGGCATATAGTGG - Intronic
1045863178 8:106836066-106836088 AATGTGTGCCTGGCCTAGGGTGG + Intergenic
1047783525 8:128131309-128131331 AATCTAAGGCTGGCATATATTGG + Intergenic
1048838312 8:138542350-138542372 AAACAATGCCTGGTACAGAGAGG + Intergenic
1051671918 9:19519174-19519196 AATCTATGCCTGGCATAGAGAGG - Intronic
1051873252 9:21763664-21763686 AATCTATTCATGGCATAGGAGGG + Intergenic
1053526124 9:38832728-38832750 ACACTATGCCTGGAACAGAGTGG + Intergenic
1053651744 9:40176547-40176569 AACTTGTGTCTGGCATAGAGCGG - Intergenic
1053902134 9:42805869-42805891 AACTTGTGTCTGGCATAGAGCGG - Intergenic
1054198351 9:62057153-62057175 ACGCTATGCCTGGAACAGAGTGG + Intergenic
1054532842 9:66199656-66199678 AACTTGTGTCTGGCATAGAGCGG + Intergenic
1054640003 9:67531210-67531232 ACGCTATGCCTGGAACAGAGTGG - Intergenic
1055026358 9:71726519-71726541 ACTGTATACCTGGCATATAGTGG - Intronic
1057722542 9:97544602-97544624 ACTGTATGCCTGGCACATAGAGG - Intronic
1057968056 9:99523829-99523851 AATCTATGCCTAGAACACAGTGG - Intergenic
1060039867 9:120290817-120290839 TGTCTGTGCCTGGCACAGAGTGG + Intergenic
1193550199 X:82883066-82883088 ATTCTATGCCTAGTATTGAGGGG - Intergenic
1194960732 X:100232486-100232508 AATCACAGCCTGGCAGAGAGTGG - Intergenic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic
1201988764 Y:20000542-20000564 AATGTATACCTAACATAGAGTGG + Intergenic