ID: 1051680456

View in Genome Browser
Species Human (GRCh38)
Location 9:19602398-19602420
Sequence GTTTATATTGGAGAAGAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051680451_1051680456 15 Left 1051680451 9:19602360-19602382 CCCAGGATTTGAACCTTGTTCTA 0: 1
1: 0
2: 3
3: 17
4: 210
Right 1051680456 9:19602398-19602420 GTTTATATTGGAGAAGAAGCAGG No data
1051680453_1051680456 2 Left 1051680453 9:19602373-19602395 CCTTGTTCTAACATCCTTTTCAC 0: 1
1: 0
2: 1
3: 14
4: 213
Right 1051680456 9:19602398-19602420 GTTTATATTGGAGAAGAAGCAGG No data
1051680452_1051680456 14 Left 1051680452 9:19602361-19602383 CCAGGATTTGAACCTTGTTCTAA 0: 1
1: 0
2: 1
3: 37
4: 346
Right 1051680456 9:19602398-19602420 GTTTATATTGGAGAAGAAGCAGG No data
1051680450_1051680456 18 Left 1051680450 9:19602357-19602379 CCACCCAGGATTTGAACCTTGTT 0: 1
1: 0
2: 3
3: 18
4: 132
Right 1051680456 9:19602398-19602420 GTTTATATTGGAGAAGAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051680456 Original CRISPR GTTTATATTGGAGAAGAAGC AGG Intronic
No off target data available for this crispr