ID: 1051687126

View in Genome Browser
Species Human (GRCh38)
Location 9:19669553-19669575
Sequence CTAAAAGCAAAGTCTCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051687123_1051687126 12 Left 1051687123 9:19669518-19669540 CCTGTAGGTCAGAATCTTACATG 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1051687126 9:19669553-19669575 CTAAAAGCAAAGTCTCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051687126 Original CRISPR CTAAAAGCAAAGTCTCTGCA GGG Intronic
No off target data available for this crispr