ID: 1051689236

View in Genome Browser
Species Human (GRCh38)
Location 9:19691769-19691791
Sequence ATTGGGCAACACTAGTATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051689231_1051689236 17 Left 1051689231 9:19691729-19691751 CCTAAAATCTTTTCAAATGTCAC 0: 1
1: 0
2: 3
3: 46
4: 478
Right 1051689236 9:19691769-19691791 ATTGGGCAACACTAGTATATAGG No data
1051689230_1051689236 20 Left 1051689230 9:19691726-19691748 CCACCTAAAATCTTTTCAAATGT 0: 1
1: 0
2: 2
3: 52
4: 469
Right 1051689236 9:19691769-19691791 ATTGGGCAACACTAGTATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051689236 Original CRISPR ATTGGGCAACACTAGTATAT AGG Intronic
No off target data available for this crispr