ID: 1051689278

View in Genome Browser
Species Human (GRCh38)
Location 9:19692280-19692302
Sequence GTCTGTTCCCAGAGTTCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051689278_1051689279 0 Left 1051689278 9:19692280-19692302 CCACTTGAACTCTGGGAACAGAC 0: 1
1: 0
2: 0
3: 15
4: 200
Right 1051689279 9:19692303-19692325 TTTCAAAGACAGATTTCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051689278 Original CRISPR GTCTGTTCCCAGAGTTCAAG TGG (reversed) Intronic
900136267 1:1118381-1118403 CTCTGCTCCCAGAGATCAGGTGG - Intergenic
902963037 1:19978190-19978212 GTCTCTGCCCAGGGTCCAAGGGG - Intronic
905953041 1:41968631-41968653 GTCTTGTGCCAGATTTCAAGGGG - Intronic
906517390 1:46447842-46447864 GTCTGTGCCCAGAATTCACGGGG + Intergenic
906757345 1:48330793-48330815 GTCTACTCACAGAGTTCAGGTGG - Intronic
906957885 1:50391121-50391143 GTCTTTTGCCAGTTTTCAAGGGG + Intergenic
911504632 1:98733424-98733446 GTCTTTTCACAGAGGACAAGTGG - Intronic
911874333 1:103139776-103139798 GTCTGGTTCCAGTTTTCAAGGGG - Intergenic
913098083 1:115538666-115538688 GTCTTTTCTCAGAATTCATGAGG + Intergenic
919500665 1:198334286-198334308 GTCTGTGCCTAAAGTTCAATAGG + Intergenic
920502709 1:206495503-206495525 GTTTGTCCCCAGAGTTTCAGAGG + Intronic
922138551 1:222857353-222857375 GTCTTGTGCCAGATTTCAAGGGG - Intergenic
1062954448 10:1530802-1530824 GTGGGTTTCCAGAGTTGAAGGGG - Intronic
1063391423 10:5652276-5652298 ACCTGGTCTCAGAGTTCAAGGGG - Intronic
1063557216 10:7092317-7092339 GTGAGTTCCCAGAGTTGACGAGG + Intergenic
1065493276 10:26304113-26304135 GTCTGTTCTCAGAGACAAAGTGG - Exonic
1067425045 10:46202986-46203008 GTGTGTTCTCAGAGTTCGTGAGG - Intergenic
1070864367 10:79697989-79698011 GTGTGTTCTCAGAGTTCGTGAGG - Intergenic
1071222624 10:83487364-83487386 GTCTCTTCCCTGTGTTCAAATGG + Intergenic
1071631267 10:87220214-87220236 GTGTGTTCTCAGAGTTCGTGAGG - Intergenic
1071782074 10:88856896-88856918 CTCTGTTCCCTCAGTCCAAGGGG + Intergenic
1075786215 10:125052009-125052031 GTGTTTTCTCAGAGTTCTAGAGG - Intronic
1077832434 11:5888642-5888664 GTCTGTTCCCAAAGTGCTGGTGG - Intronic
1078891060 11:15559712-15559734 GTCTGTGTCCAGAGGTCTAGGGG - Intergenic
1079786839 11:24683941-24683963 GTCTGTCCCCCGAGATCAAGAGG - Intronic
1082254700 11:50020707-50020729 CTCTGCTCCCTGGGTTCAAGTGG - Intergenic
1085152887 11:74266268-74266290 GTTTGTTCCTGGACTTCAAGAGG + Intronic
1086496895 11:87413364-87413386 GTCTTTTGCCAGTTTTCAAGGGG - Intergenic
1088066053 11:105720961-105720983 GTTGGTTCCCAGAAGTCAAGTGG + Intronic
1088068534 11:105752980-105753002 GTCTGTTCCCAGTATTCTAGAGG + Exonic
1088528335 11:110780757-110780779 GTTTGCTCACAGAGTACAAGTGG - Intergenic
1090238014 11:125163942-125163964 GTGAGTTCCCAGAGTTCTGGGGG - Intergenic
1090321568 11:125848957-125848979 GTCTTTTGCCAGTTTTCAAGGGG - Intergenic
1092516402 12:9218933-9218955 GTCTCATCCCAGTTTTCAAGAGG - Intergenic
1095366452 12:41412187-41412209 GTCTGTGCACATTGTTCAAGGGG - Intronic
1097824913 12:64165525-64165547 GTCTGGTGCCAGTTTTCAAGGGG - Intergenic
1097910345 12:64962789-64962811 GTCTTATGCCAGATTTCAAGGGG + Intergenic
1099771569 12:87065453-87065475 GTCTTTTTCCAGTTTTCAAGGGG - Intergenic
1100115653 12:91300371-91300393 GTCTTGTGCCAGATTTCAAGGGG - Intergenic
1100266944 12:92986414-92986436 CTCTGCTTCCCGAGTTCAAGCGG - Intergenic
1101492280 12:105220749-105220771 GGCTGTACCCAAAGCTCAAGGGG + Intronic
1102290570 12:111695927-111695949 CTCTGTTTCCCGGGTTCAAGTGG - Intronic
1102309200 12:111831231-111831253 GTCTTTTGCCAGTTTTCAAGGGG + Intergenic
1102820733 12:115907224-115907246 CTCTGTCTCCTGAGTTCAAGTGG - Intergenic
1105027375 12:132857951-132857973 ATCTGTTTGCAGAGTTCACGGGG + Intronic
1105064474 12:133184699-133184721 GTCTGCTTCCCGAGTTCAAGTGG + Intronic
1105287563 13:19018276-19018298 GTCTGATCTCTGAGTTCTAGGGG - Intergenic
1107016558 13:35712123-35712145 GTGTGTGCCCCGAGTTCCAGTGG + Intergenic
1107249215 13:38338171-38338193 GTGTGTTCCCAGCCATCAAGTGG - Intergenic
1108080111 13:46726675-46726697 GTCTGCTCCCAGAGTTTCAGTGG + Intronic
1108613149 13:52103853-52103875 GTCTTTTCCCAGAGGTCACATGG - Intronic
1110514832 13:76397712-76397734 GTTTGTTTCCAGCGTTTAAGAGG - Intergenic
1110525711 13:76534227-76534249 GTCTTGTCCCAGTTTTCAAGGGG - Intergenic
1110746383 13:79058259-79058281 ATCTATTCCCATAGATCAAGGGG + Intergenic
1111528771 13:89509285-89509307 GTCTGATCCCAAAGTCCAGGTGG - Intergenic
1112102568 13:96205886-96205908 GTCTTTTGCCAGTTTTCAAGGGG - Intronic
1113140583 13:107144409-107144431 TTATTCTCCCAGAGTTCAAGAGG - Intergenic
1113186367 13:107690461-107690483 GTTTGTTCAGAGAGTTAAAGTGG + Intronic
1113605400 13:111601028-111601050 CTCTGCCCCCAGGGTTCAAGTGG - Intronic
1115662864 14:35514163-35514185 GTATGTTACTAGGGTTCAAGAGG - Intergenic
1116671655 14:47849980-47850002 GTCTTGTGCCAGATTTCAAGGGG - Intergenic
1116671660 14:47850034-47850056 GTCTTGTGCCAGATTTCAAGGGG - Intergenic
1118634257 14:67733265-67733287 ATCTGTCCCCAGAATTCAAGAGG + Intronic
1120177086 14:81306053-81306075 GGCTGCTCACAGAGTTGAAGGGG - Intronic
1120620435 14:86756677-86756699 GTCTGCCTCCACAGTTCAAGTGG - Intergenic
1122316931 14:100831254-100831276 CCCTGTTCCCTGAGTTCTAGAGG + Intergenic
1125174974 15:36810862-36810884 ATCTGTTTCCAGACTTCAAATGG - Intergenic
1127100527 15:55560106-55560128 GTCTTTTGCCAGTTTTCAAGGGG - Intronic
1127387418 15:58477840-58477862 GTCAGTTCCCACAGGTCTAGGGG - Intronic
1127769671 15:62221039-62221061 GTGAGTTTCCAGAGTTTAAGGGG - Intergenic
1127933144 15:63610929-63610951 GGCTGTACCCAGTGTTCAGGAGG + Intronic
1129679814 15:77652333-77652355 GTCTGTTCCCAGAGTCCCCGGGG + Intronic
1134009143 16:10838431-10838453 TTCTGGTCCCAGAGCTCATGAGG + Intergenic
1138989550 16:62374833-62374855 GTCTGGTACCAGTTTTCAAGGGG - Intergenic
1140050024 16:71472341-71472363 ATCTGTTCTCACAGTTCTAGAGG - Intronic
1140471615 16:75218687-75218709 TTCTGTTCCCAGAGGGGAAGTGG - Intergenic
1143393807 17:6576236-6576258 GTCTGTTGCCTGAGTTCACTTGG + Intergenic
1144101296 17:11944481-11944503 GTCTGTTCTCAGAGTTAACATGG + Intronic
1144812834 17:18011701-18011723 GTCTCCTCCCAGAGGTCAGGGGG - Intronic
1145809198 17:27754699-27754721 CTCTCTTCCCAGAGGTCAACTGG - Intergenic
1148341200 17:46874513-46874535 GTATGTTCCCAGATTCCCAGAGG - Intronic
1148751981 17:49950606-49950628 GCCTGTTCAAAGAGTCCAAGGGG + Intergenic
1150139405 17:62715764-62715786 GTCTGTTACCAGGCCTCAAGCGG - Intronic
1150976503 17:70093243-70093265 GTATTTTCTCACAGTTCAAGAGG + Intronic
1152010632 17:77711464-77711486 TTATGTTCCTAGAGTTCTAGGGG - Intergenic
1152561498 17:81081104-81081126 GCCAGTTCCCAGTGTCCAAGGGG + Intronic
1155092655 18:22526642-22526664 CTCTGTCTCCAGGGTTCAAGTGG - Intergenic
1157334017 18:46724092-46724114 CTCTGTTCCCATCTTTCAAGAGG + Intronic
1161519170 19:4713994-4714016 CTCTGTTCCCAGAGGTCCACAGG - Intronic
1163184282 19:15626908-15626930 CTCTGTTCCCACATTTCCAGTGG + Intronic
1163429417 19:17258184-17258206 GCCAGTTCCCAGGGTTCCAGGGG + Intronic
1164281703 19:23774785-23774807 GTCTGTGCCCTGATTTCAGGAGG + Intronic
1165814752 19:38634935-38634957 GCCTGATCCCACAGTTCCAGGGG - Intronic
1168209106 19:54876396-54876418 GTCTTTTGCCAGTTTTCAAGGGG + Intronic
925024976 2:600592-600614 CTCTGTCCCCAGACTTCAAAAGG + Intergenic
926505251 2:13706081-13706103 GTATGTTCTCATAGTTCTAGAGG - Intergenic
927728998 2:25453703-25453725 CTCTGTTCCTAGAGACCAAGAGG + Intronic
929969625 2:46563017-46563039 TTCTTTTCCCAGTGTTTAAGAGG + Intronic
930392985 2:50785219-50785241 GTATTTTCTCAGAGTTCTAGAGG - Intronic
931614160 2:64138640-64138662 TTCTGTTTCCTGGGTTCAAGTGG - Intronic
934891190 2:98070926-98070948 GTCTCTTCCCCGAGCTCCAGTGG + Intergenic
938238815 2:129727294-129727316 TTCTGTTCCCAGCGTTCCAGTGG + Intergenic
939136978 2:138308613-138308635 GTCTGTTTTCAGAATTAAAGTGG + Intergenic
940279709 2:151976639-151976661 GGCTGATCCCAGAGTTCCAGAGG + Intronic
943408703 2:187519650-187519672 GTCTCTTACCAGAGCTCGAGTGG + Intronic
945509041 2:210677784-210677806 GTCTGTCCCCAGTTTTCAAAGGG - Intronic
945906441 2:215598864-215598886 CTCTGATCTTAGAGTTCAAGTGG + Intergenic
945942346 2:215962145-215962167 GTCTGTTTCCAGAACTCAAGTGG - Intronic
946448610 2:219761027-219761049 GCCAGTTCTCAGAGTTCAACAGG - Intergenic
946515682 2:220408603-220408625 GTCTGGTACCAGTTTTCAAGGGG + Intergenic
948276721 2:236714649-236714671 CTCTCTTCCCAGACTCCAAGAGG + Intergenic
1169565142 20:6845719-6845741 CTTTGTTCCCAAAGTTGAAGTGG - Intergenic
1170064713 20:12298924-12298946 GCCGGTTCCCAGACTTCAGGTGG + Intergenic
1171257733 20:23703531-23703553 CTCTTTTCCCAGGATTCAAGGGG + Intergenic
1173919289 20:46731716-46731738 CTCTGTCCCTAGAGTTCAGGGGG + Intronic
1174506434 20:51020672-51020694 GCCTGTTGCCAGAGGTCTAGGGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
1178414786 21:32394980-32395002 CTCTTTGCCCAGAGCTCAAGTGG + Intergenic
1182919898 22:34069645-34069667 GTATGCTCCCACAGTTCTAGAGG + Intergenic
1182962534 22:34488982-34489004 CTCTGTTCCCAGTGTGCTAGGGG - Intergenic
955404459 3:58617262-58617284 ACCTGTTCCCAGAGCTCAGGTGG + Intronic
956375096 3:68605869-68605891 GTCTTTTGCCAGTTTTCAAGGGG - Intergenic
957611055 3:82467030-82467052 GTGTATTCCAAGAGGTCAAGAGG - Intergenic
957746053 3:84344863-84344885 GTCTTTTACCAGTTTTCAAGGGG + Intergenic
958523559 3:95223253-95223275 GTCTTTTGCCAGTTTTCAAGGGG + Intergenic
959209741 3:103362618-103362640 GTCTTTTGCCAGTTTTCAAGGGG - Intergenic
959812889 3:110639679-110639701 CTGTGTTCCCAGAGAGCAAGTGG - Intergenic
960195187 3:114757611-114757633 TTCTGTCCTCAGATTTCAAGAGG - Intronic
961567360 3:127773257-127773279 GTCTGGCTCTAGAGTTCAAGGGG - Intronic
963180210 3:142347489-142347511 GTCTGGTGATAGAGTTCAAGTGG - Intronic
963561478 3:146871406-146871428 GTCTTTTTCCAGTTTTCAAGGGG + Intergenic
964088989 3:152850884-152850906 CCATGTTCCCAGAGGTCAAGTGG + Intergenic
964296689 3:155240852-155240874 GTCTCCTCCCAGAGCCCAAGAGG - Intergenic
964744319 3:159998019-159998041 GTCTGGGCCCAGAGATCAGGAGG + Intergenic
965159687 3:165116377-165116399 GTCTTTTACCAGTTTTCAAGGGG - Intergenic
969446762 4:7249349-7249371 GACTGTTCCAAGAGTGGAAGTGG + Intronic
969507072 4:7594669-7594691 GTGTGTGGCCAGAGTTGAAGAGG - Intronic
969845502 4:9917078-9917100 GTCTGTTGCCAGTGTGAAAGAGG - Intronic
976975522 4:91162002-91162024 GTCTGGTGCCAGATTTCAAAGGG + Intronic
977332523 4:95655476-95655498 GTCTTTTCCCAGTTTTCAAGGGG + Intergenic
979148789 4:117280629-117280651 GTCTTTTGCCAGTTTTCAAGGGG + Intergenic
979431180 4:120633464-120633486 GTCTGAGCCCAGAACTCAAGAGG + Intergenic
979690469 4:123553650-123553672 TTCTCTCACCAGAGTTCAAGAGG + Intergenic
980794587 4:137664381-137664403 GTCTGTTTCCAGAGTTATAATGG - Intergenic
982590523 4:157303551-157303573 GTCTGCTCCCAGTTTTCGAGAGG + Exonic
983031790 4:162811834-162811856 GTTTTTTCTCACAGTTCAAGAGG + Intergenic
984628161 4:182032120-182032142 GTCTTGTCCCAGTTTTCAAGTGG + Intergenic
986799786 5:11246996-11247018 GTCAGATCCCAGCGTTCCAGTGG - Intronic
986877907 5:12132861-12132883 ACCTGTCCACAGAGTTCAAGTGG - Intergenic
987234793 5:15931826-15931848 GTCTGTTCAGAGAGTTCTCGAGG - Intronic
988195479 5:27999927-27999949 GACTTTTTCCAGTGTTCAAGAGG + Intergenic
988268607 5:28984866-28984888 GTCTTGTGCCAGATTTCAAGGGG - Intergenic
988943159 5:36166881-36166903 GTCTCTTCCCAGGGTGAAAGAGG + Intronic
990685095 5:58292080-58292102 GTCTTTTGCCAGATTTCAAAGGG - Intergenic
990927745 5:61047831-61047853 GTATGTGCCTAGAGTTAAAGTGG + Intronic
993107754 5:83618823-83618845 GTCTGTTATCACTGTTCAAGGGG + Intergenic
993995468 5:94717444-94717466 GTCTTGTGCCAGATTTCAAGGGG - Intronic
994086423 5:95764201-95764223 GTGTATTCCCAGAGCTCCAGGGG - Intronic
994456247 5:100011742-100011764 GTCTGTTCCCATTTTTCAATTGG - Intergenic
995559633 5:113366610-113366632 TTCTGTTCCCAGAGTCCATAAGG + Intronic
996306422 5:122053177-122053199 GCCTGGTCACAGAGTTCAGGTGG + Intronic
996667926 5:126082193-126082215 GTGTGTTCTTAGAGCTCAAGTGG - Intergenic
1003379242 6:5607780-5607802 GACCTTTCCCAGAGATCAAGTGG + Intronic
1003798516 6:9633812-9633834 GGCTGTGCTCAGAGTGCAAGAGG + Intronic
1004371968 6:15060527-15060549 ATCTATTCCCACAGTTCAGGAGG + Intergenic
1004797594 6:19105153-19105175 GTCTTATGCCAGATTTCAAGGGG - Intergenic
1004929784 6:20451628-20451650 GTCTTTTGCCAGTTTTCAAGGGG + Intronic
1005129945 6:22495169-22495191 CTCTGCCCCCAGGGTTCAAGTGG - Intergenic
1006196307 6:32244646-32244668 GTCTTTTCTCACAGTTCTAGAGG - Intergenic
1006930561 6:37685571-37685593 CTCTGTTCCCAGAAATCAGGAGG + Intronic
1007971479 6:46056294-46056316 TTCTGAGCCCAGAATTCAAGAGG - Intronic
1010272192 6:73927236-73927258 GTGTGTTCCCAGAATTCAGGTGG - Intergenic
1010294535 6:74181283-74181305 ACCTGTTCCCAGAATCCAAGAGG + Intergenic
1010648486 6:78423076-78423098 GTCTTTTGCCAGTTTTCAAGAGG - Intergenic
1011992486 6:93540350-93540372 GTCTTTTGCCAGTTTTCAAGGGG - Intergenic
1012366651 6:98448961-98448983 TTCACTTCCCATAGTTCAAGAGG - Intergenic
1013692703 6:112665330-112665352 GTCTGTTCCCAGAGATCCTAGGG - Intergenic
1015042119 6:128733544-128733566 ATCTGTTACCAAAGTTCATGTGG + Intergenic
1016088191 6:139942001-139942023 ATATGTTCCCAGAGCTCCAGTGG - Intergenic
1019637399 7:2083365-2083387 GTCAGTTCTTAAAGTTCAAGAGG - Intronic
1020713184 7:11635067-11635089 GTCTGTTACAAGATTTCCAGAGG + Intronic
1023028295 7:36071783-36071805 GGCTGTTCCCATATTTCAATAGG + Intergenic
1023238685 7:38118531-38118553 GTCTTGTGCCAGATTTCAAGGGG - Intergenic
1024106119 7:46088415-46088437 GTCTGTTCTCAGAGCTCAAATGG + Intergenic
1025145913 7:56503474-56503496 CTCTGTTTCCCGGGTTCAAGCGG - Intergenic
1026866380 7:73826572-73826594 CCCTGTCCCCAGAGTTCCAGGGG - Intronic
1028313880 7:89375266-89375288 CTCTGTTCCCATAGTTTATGTGG + Intergenic
1031994900 7:128223623-128223645 CTCTACTCCCAGAGTTCAAGTGG - Intergenic
1034946227 7:155263541-155263563 GTCTGTTCACCAAGCTCAAGAGG - Intergenic
1036058804 8:5291096-5291118 GCCTGTTCCCAGTGGCCAAGAGG - Intergenic
1036480654 8:9136357-9136379 TTTTGTACACAGAGTTCAAGGGG - Exonic
1036508501 8:9378894-9378916 GTATTTTCTCACAGTTCAAGAGG + Intergenic
1037127494 8:15368815-15368837 GTCTCTTCTCACAGTTCTAGAGG - Intergenic
1042115388 8:65426112-65426134 TTCTGTTCTCACAGTTCTAGAGG - Intergenic
1043805303 8:84664894-84664916 GTCTTTTGCCAGTTTTCAAGGGG + Intronic
1046682941 8:117192085-117192107 GCCTGTTCTCAGATCTCAAGTGG - Intergenic
1047780399 8:128106365-128106387 GTCTTCTCCCAGAGGTCCAGGGG - Intergenic
1051689278 9:19692280-19692302 GTCTGTTCCCAGAGTTCAAGTGG - Intronic
1053558228 9:39160579-39160601 GTCTTGTCCCAGTTTTCAAGGGG - Intronic
1053822345 9:41980816-41980838 GTCTTGTCCCAGTTTTCAAGGGG - Intronic
1054138887 9:61458347-61458369 GTCTTGTCCCAGTTTTCAAGGGG + Intergenic
1054608231 9:67206562-67206584 GTCTTGTCCCAGTTTTCAAGGGG + Intergenic
1055630217 9:78216044-78216066 TTATTTTCTCAGAGTTCAAGAGG - Intergenic
1056495374 9:87149954-87149976 GTTTGTTCCCACAGTTCTGGGGG - Intronic
1062049986 9:134442311-134442333 GGCTGTGCCCAGAGTCCAGGGGG - Intergenic
1186791406 X:13003358-13003380 CTCCGTCCCCCGAGTTCAAGCGG + Intergenic
1191702627 X:64059572-64059594 GTCTTGTGCCAGATTTCAAGGGG + Intergenic
1191726484 X:64286885-64286907 GTCTGTTGCCAGTTTTCAAAGGG - Intronic
1191727688 X:64298647-64298669 GTCTGTTGCCAGTTTTCAAAGGG + Intronic
1193015436 X:76727370-76727392 GTCTTTTGCCAGTTTTCAAGGGG + Intergenic
1193259099 X:79384127-79384149 GTCTTTTCCCAGTTTTCAAGGGG - Intergenic
1194365075 X:93004842-93004864 GTCTTTTGCCAGTTTTCAAGGGG + Intergenic
1195024162 X:100859000-100859022 GTCTTTTTCCAGTTTTCAAGGGG + Intronic
1197456012 X:126676168-126676190 GTCTCTTGCCAGTTTTCAAGGGG - Intergenic
1199706750 X:150433477-150433499 GTCTTGTCCCAGTTTTCAAGGGG + Intronic
1201312437 Y:12608975-12608997 CTCTGCCTCCAGAGTTCAAGTGG + Intergenic