ID: 1051695895

View in Genome Browser
Species Human (GRCh38)
Location 9:19767597-19767619
Sequence GAGGGTAAGCAGAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3016
Summary {0: 7, 1: 218, 2: 640, 3: 931, 4: 1220}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051695895_1051695902 15 Left 1051695895 9:19767597-19767619 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1051695902 9:19767635-19767657 CTGTCTAACCAGTCCCAGTGAGG No data
1051695895_1051695904 23 Left 1051695895 9:19767597-19767619 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1051695904 9:19767643-19767665 CCAGTCCCAGTGAGGTGAACCGG 0: 5
1: 115
2: 351
3: 422
4: 404
1051695895_1051695905 24 Left 1051695895 9:19767597-19767619 CCACCCTGCTTCTGCTTACCCTC 0: 7
1: 218
2: 640
3: 931
4: 1220
Right 1051695905 9:19767644-19767666 CAGTCCCAGTGAGGTGAACCGGG 0: 9
1: 328
2: 816
3: 1305
4: 1040

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051695895 Original CRISPR GAGGGTAAGCAGAAGCAGGG TGG (reversed) Intronic
Too many off-targets to display for this crispr