ID: 1051698090

View in Genome Browser
Species Human (GRCh38)
Location 9:19789873-19789895
Sequence GGGAGAGAACAGAAGGATGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051698090_1051698102 17 Left 1051698090 9:19789873-19789895 CCTCCATCCTTCTGTTCTCTCCC No data
Right 1051698102 9:19789913-19789935 TTCATGCCCTCCTTACAATGGGG No data
1051698090_1051698101 16 Left 1051698090 9:19789873-19789895 CCTCCATCCTTCTGTTCTCTCCC No data
Right 1051698101 9:19789912-19789934 CTTCATGCCCTCCTTACAATGGG No data
1051698090_1051698106 24 Left 1051698090 9:19789873-19789895 CCTCCATCCTTCTGTTCTCTCCC No data
Right 1051698106 9:19789920-19789942 CCTCCTTACAATGGGGGTAATGG No data
1051698090_1051698100 15 Left 1051698090 9:19789873-19789895 CCTCCATCCTTCTGTTCTCTCCC No data
Right 1051698100 9:19789911-19789933 TCTTCATGCCCTCCTTACAATGG No data
1051698090_1051698094 -10 Left 1051698090 9:19789873-19789895 CCTCCATCCTTCTGTTCTCTCCC No data
Right 1051698094 9:19789886-19789908 GTTCTCTCCCCCATCCAAGAGGG No data
1051698090_1051698103 18 Left 1051698090 9:19789873-19789895 CCTCCATCCTTCTGTTCTCTCCC No data
Right 1051698103 9:19789914-19789936 TCATGCCCTCCTTACAATGGGGG No data
1051698090_1051698107 25 Left 1051698090 9:19789873-19789895 CCTCCATCCTTCTGTTCTCTCCC No data
Right 1051698107 9:19789921-19789943 CTCCTTACAATGGGGGTAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051698090 Original CRISPR GGGAGAGAACAGAAGGATGG AGG (reversed) Intergenic
No off target data available for this crispr