ID: 1051699644

View in Genome Browser
Species Human (GRCh38)
Location 9:19808114-19808136
Sequence TTCTTTCTGGATCTTGCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051699637_1051699644 23 Left 1051699637 9:19808068-19808090 CCAAGGACTCCCTACAGATGGGG No data
Right 1051699644 9:19808114-19808136 TTCTTTCTGGATCTTGCTTCAGG No data
1051699640_1051699644 13 Left 1051699640 9:19808078-19808100 CCTACAGATGGGGAGTTACTGAG No data
Right 1051699644 9:19808114-19808136 TTCTTTCTGGATCTTGCTTCAGG No data
1051699633_1051699644 25 Left 1051699633 9:19808066-19808088 CCCCAAGGACTCCCTACAGATGG No data
Right 1051699644 9:19808114-19808136 TTCTTTCTGGATCTTGCTTCAGG No data
1051699639_1051699644 14 Left 1051699639 9:19808077-19808099 CCCTACAGATGGGGAGTTACTGA No data
Right 1051699644 9:19808114-19808136 TTCTTTCTGGATCTTGCTTCAGG No data
1051699635_1051699644 24 Left 1051699635 9:19808067-19808089 CCCAAGGACTCCCTACAGATGGG No data
Right 1051699644 9:19808114-19808136 TTCTTTCTGGATCTTGCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051699644 Original CRISPR TTCTTTCTGGATCTTGCTTC AGG Intergenic
No off target data available for this crispr