ID: 1051707869

View in Genome Browser
Species Human (GRCh38)
Location 9:19899504-19899526
Sequence ACTGGCCTTCTCCTGGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051707869_1051707874 2 Left 1051707869 9:19899504-19899526 CCTTATACCAGGAGAAGGCCAGT No data
Right 1051707874 9:19899529-19899551 CCCTCACATCATGAAAGCTTGGG No data
1051707869_1051707876 3 Left 1051707869 9:19899504-19899526 CCTTATACCAGGAGAAGGCCAGT No data
Right 1051707876 9:19899530-19899552 CCTCACATCATGAAAGCTTGGGG No data
1051707869_1051707872 1 Left 1051707869 9:19899504-19899526 CCTTATACCAGGAGAAGGCCAGT No data
Right 1051707872 9:19899528-19899550 ACCCTCACATCATGAAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051707869 Original CRISPR ACTGGCCTTCTCCTGGTATA AGG (reversed) Intergenic
No off target data available for this crispr