ID: 1051707923

View in Genome Browser
Species Human (GRCh38)
Location 9:19900014-19900036
Sequence CCTCAAGTAGTGAAGGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051707923_1051707934 27 Left 1051707923 9:19900014-19900036 CCCTGAACCTTCACTACTTGAGG No data
Right 1051707934 9:19900064-19900086 CATAAAAGTGCCATGGCCCAAGG No data
1051707923_1051707933 20 Left 1051707923 9:19900014-19900036 CCCTGAACCTTCACTACTTGAGG No data
Right 1051707933 9:19900057-19900079 TGTAGTTCATAAAAGTGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051707923 Original CRISPR CCTCAAGTAGTGAAGGTTCA GGG (reversed) Intergenic
No off target data available for this crispr