ID: 1051708887

View in Genome Browser
Species Human (GRCh38)
Location 9:19909762-19909784
Sequence GAAAATCAACAGATGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1051708887_1051708893 28 Left 1051708887 9:19909762-19909784 CCTTCCTGCATCTGTTGATTTTC No data
Right 1051708893 9:19909813-19909835 TGCCAGAGTGGTGTATATTGGGG No data
1051708887_1051708891 26 Left 1051708887 9:19909762-19909784 CCTTCCTGCATCTGTTGATTTTC No data
Right 1051708891 9:19909811-19909833 TATGCCAGAGTGGTGTATATTGG No data
1051708887_1051708890 16 Left 1051708887 9:19909762-19909784 CCTTCCTGCATCTGTTGATTTTC No data
Right 1051708890 9:19909801-19909823 AAAAAACGGTTATGCCAGAGTGG No data
1051708887_1051708892 27 Left 1051708887 9:19909762-19909784 CCTTCCTGCATCTGTTGATTTTC No data
Right 1051708892 9:19909812-19909834 ATGCCAGAGTGGTGTATATTGGG No data
1051708887_1051708889 2 Left 1051708887 9:19909762-19909784 CCTTCCTGCATCTGTTGATTTTC No data
Right 1051708889 9:19909787-19909809 TTGCTTTCAGCTCAAAAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1051708887 Original CRISPR GAAAATCAACAGATGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr